gdb/50: linux-threads.c: doesn't find thread info after re-run

wtw@netapp.com wtw@netapp.com
Mon Apr 30 14:48:00 GMT 2001


>Number:         50
>Category:       gdb
>Synopsis:       linux-threads.c: doesn't find thread info after re-run
>Confidential:   no
>Severity:       serious
>Priority:       medium
>Responsible:    unassigned
>State:          open
>Class:          sw-bug
>Submitter-Id:   net
>Arrival-Date:   Mon Apr 30 14:48:00 PDT 2001
>Closed-Date:
>Last-Modified:
>Originator:     wtw@netapp.com
>Release:        unknown-1.0
>Organization:
>Environment:
Linux 2.2.14
>Description:
GDB 5.0 linux-threads.c module (*not* the lin-threads.c
libthread_db-based module).  When a multithreaded
program is run, linuxthreads_new_objfile() 
reads several variables from the objfile including
linuxthreads_max.  When the inferior process is killed,
the state is reset (linuxthreads_max = 0), indicating
that the program is not multithreaded.

But, when it's re-run from the CLI, the objfile
is not re-examined, and linuxthreads_max stays 0,
so gdb thinks the inferior is non-multithreaded
even though it is.

Here's the sequence of events:
Initial startup of "gdb progname":
  new_objfile(0)
  new_objfile(foo) -> read pthread vars, set linuxthreads_max
"run"
  create_inferior()
  new_objfile(bar)
  ..
"kill"
  linuxthreads_kill()
  mourn_inferior() -> linuxthreads_max = 0
"run"
  create_inferior()

What should happen in the 2nd "run" is that
linuxthreads_max and the other variables
are re-read from the objfile.  Or, mourn_inferior
shouldn't nuke them; only changing the objfile
should nuke them.
>How-To-Repeat:
I've provided a Linux binary 
that exhibits this behaviour.  A normal
Linux multithreaded program does not, because
most of them use libpthread and thus use
the lin-threads module, not linux-threads.c.

The attached program uses a home-grown thread library
based on clone() and the linux-thread API for making
GDB thread-aware.  Note that it will NOT work
on current GDB CVS tree, because linux-threads.c
has been disabled.  You need 5.0 release.
>Fix:

>Release-Note:
>Audit-Trail:
>Unformatted:
----gnatsweb-attachment----
Content-Type: application/octet-stream; name="test-pthread"
Content-Transfer-Encoding: base64
Content-Disposition: attachment; filename="test-pthread"

f0VMRgEBAQAAAAAAAAAAAAIAAwABAAAAoI0ECDQAAACUzwAAAAAAADQAIAAGACgAHgAbAAYAAAA0
AAAANIAECDSABAjAAAAAwAAAAAUAAAAEAAAAAwAAAPQAAAD0gAQI9IAECBMAAAATAAAABAAAAAEA
AAABAAAAAAAAAACABAgAgAQIWioAAFoqAAAFAAAAABAAAAEAAABgKgAAYLoECGC6BAjEAgAAxAUQ
AAYAAAAAEAAAAgAAAIQsAACEvAQIhLwECKAAAACgAAAABgAAAAQAAAAEAAAACAEAAAiBBAgIgQQI
IAAAACAAAAAEAAAABAAAAC9saWIvbGQtbGludXguc28uMgAABAAAABAAAAABAAAAR05VAAAAAAAC
AAAAAAAAAAAAAAAlAAAAOgAAAAAAAAAwAAAAAAAAAAAAAAAOAAAAKwAAAC4AAAA1AAAAOQAAACcA
AAAtAAAANAAAAA8AAAAVAAAAMgAAABAAAAAJAAAAHwAAAAAAAAAAAAAAGgAAADgAAAAqAAAANgAA
AAAAAAAxAAAAAAAAAAAAAAAgAAAAKQAAAAAAAAAsAAAAFAAAAC8AAAAAAAAABAAAABYAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAABAAAAAgAAAAAAAAAAAAAAAAAAAAgAAAAA
AAAADAAAAAAAAAARAAAAAAAAAAAAAAAFAAAABgAAABIAAAAAAAAACwAAAAAAAAAAAAAAAAAAABMA
AAAAAAAAGwAAAAAAAAAAAAAAAAAAABgAAAANAAAAHQAAAAAAAAAjAAAAAAAAACUAAAAAAAAAJgAA
ACIAAAAKAAAABwAAABkAAAAeAAAAKAAAACEAAAAkAAAAHAAAAAAAAAAXAAAAMwAAADcAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAABoAAAC4uwQIBAAAABEAEABjAgAAQIsECGwAAAASAAAATAAAANiaBAia
AQAAEgANAFkBAABQiwQIHgAAABIAAAAyAAAA3JkECHoAAAASAA0AiAAAAGCLBAgvAAAAEgAAAAkB
AABwiwQIOwAAABIAAAB7AgAAgIsECHQAAAAiAAAAEwEAAJCLBAg9AAAAEgAAAHAAAAAEpQQIDwAA
ABIADQAvAQAAoIsECCQAAAASAAAAlQAAAPSkBAgPAAAAEgANAHgBAACwiwQIzgAAABIAAABhAQAA
wIsECH8AAAASAAAAcQEAANCLBAg5AAAAEgAAAI8AAADgiwQISQAAABIAAACtAAAA8IsECLcBAAAS
AAAA2wAAABSlBAhOAAAAEgANAG8CAAAAjAQILwAAABIAAADxAAAAvLsECAQAAAARABAA1gAAABCM
BAg3AAAAEgAAADwBAAAgjAQIogAAACIAAAAZAQAAWJoECDoAAAASAA0ArgEAAEC9BAgEAAAAEQAW
ANAAAAAwjAQIswEAABIAAACRAgAAQIwECJlJAAASAAAARAAAAFCMBAglAAAAEgAAAGkCAABgjAQI
sAAAABIAAABcAgAAcIwECB8AAAASAAAAwAAAAICMBAhUAAAAEgAAAGcBAABcnQQIAgEAABIADQCw
AgAAkIwECLgAAAASAAAASgIAAKCMBAgFAQAAEgAAAKUCAACwjAQIIwAAABIAAACGAQAAhKQECBMA
AAASAA0AmwEAADijBAgcAAAAEgANAGcAAADAjAQIJwAAABIAAABbAAAA0IwECDsAAAASAAAAtQEA
AMScBAheAAAAEgANAMoAAADgjAQIMwAAABIAAAAIAgAA8IwECOgAAAASAAAAHQIAAACNBAgjAAAA
EgAAAJoCAAAQjQQIrAAAABIAAACrAgAAII0ECMcAAAASAAAAwgEAAMikBAgKAAAAEgANANgBAAAY
pAQIagAAABIADQAxAgAAMI0ECDYAAAASAAAA9wEAAByjBAgcAAAAEgANALQAAABAjQQIOwAAABIA
AAAXAgAAUI0ECHkAAAASAAAAIgIAAESoBAgEAAAAEQAPADcBAABgjQQIOwAAABIAAAA3AgAABKQE
CBMAAAASAA0A6wEAAHCNBAhTAgAAEgAAAA0CAACAjQQIWAAAABIAAABUAQAAkI0ECD0AAAASAAAA
AQAAAAAAAAAAAAAAIAAAAABfX2dtb25fc3RhcnRfXwBsaWJjLnNvLjYAX19saWJjX2ludGVybmFs
X3RzZF9zZXQAcHRocmVhZF9hdHRyX2luaXQAd2FpdHBpZABwdGhyZWFkX2NyZWF0ZQBzaWdlbXB0
eXNldABzbnByaW50ZgBfX2xpYmNfY3VycmVudF9zaWdydG1heABnZXRwaWQAcHJjdGwAX19saWJj
X2N1cnJlbnRfc2lncnRtaW4AbWFsbG9jAHNpZ2FsdHN0YWNrAHNpZ2FkZHNldABiemVybwBhYm9y
dABwaXBlAF9fbGliY19hbGxvY2F0ZV9ydHNpZwBfX2xpYmNfaW50ZXJuYWxfdHNkX2dldABuYW5v
c2xlZXAAd3JpdGUAcHRocmVhZF9hdHRyX3NldHNjb3BlAGZwcmludGYAa2lsbABfX2RlcmVnaXN0
ZXJfZnJhbWVfaW5mbwByZWFkAHNldHBncnAAYmNvcHkAc2lnYWN0aW9uAGtpbGxwZwBfX2Fzc2Vy
dF9mYWlsAHB0aHJlYWRfbXV0ZXhfdW5sb2NrAF9faF9lcnJub19sb2NhdGlvbgBzdGRlcnIAcHRo
cmVhZF9zZWxmAHB0aHJlYWRfbXV0ZXhfZGVzdHJveQBwdGhyZWFkX211dGV4X2xvY2sAX19zaWdh
Y3Rpb24AX19lcnJub19sb2NhdGlvbgBleGl0AHNpZ2RlbHNldABmb3BlbgBhdG9pAF9JT19zdGRp
bl91c2VkAF9leGl0AHB0aHJlYWRfbXV0ZXhfaW5pdABfX2xpYmNfc3RhcnRfbWFpbgBzdHJsZW4A
Y2xvbmUAZnB1dHMAc2NoZWRfeWllbGQAX19yZWdpc3Rlcl9mcmFtZV9pbmZvAHZmcHJpbnRmAHNp
Z3N1c3BlbmQAcmFpc2UAZnJlZQBzaWdwcm9jbWFzawBHTElCQ18yLjEAR0xJQkNfMi4wAAAAAQAC
AAEAAgABAAIAAgACAAIAAQACAAEAAgACAAIAAgACAAEAAgABAAIAAgABAAIAAgACAAIAAgACAAIA
AQACAAIAAgABAAEAAgACAAEAAgACAAIAAgACAAEAAQACAAEAAgADAAEAAgABAAIAAgACAAAAAQAC
ABAAAAAQAAAAAAAAABFpaQ0AAAMAvAIAABAAAAAQaWkNAAACAMYCAAAAAAAAgLwECAY5AABAvQQI
BRgAAOi7BAgHAgAA7LsECAcEAADwuwQIBwYAAPS7BAgHBwAA+LsECAcIAAD8uwQIBwkAAAC8BAgH
CwAABLwECAcNAAAIvAQIBw4AAAy8BAgHDwAAELwECAcQAAAUvAQIBxEAABi8BAgHEwAAHLwECAcV
AAAgvAQIBxYAACS8BAgHGQAAKLwECAcaAAAsvAQIBxsAADC8BAgHHAAANLwECAcdAAA4vAQIBx4A
ADy8BAgHIAAAQLwECAchAABEvAQIByIAAEi8BAgHJQAATLwECAcmAABQvAQIBygAAFS8BAgHKQAA
WLwECAcqAABcvAQIBysAAGC8BAgHLAAAZLwECAcvAABovAQIBzEAAGy8BAgHMgAAcLwECAc0AAB0
vAQIBzYAAHi8BAgHNwAAfLwECAc4AABVieVT6AAAAABbgcPTMAAAg7ukAAAAAHQF6OJ0+/eJ9uj7
AgAA6LYcAACLXfzJwwD/NeC7BAj/JeS7BAgAAAAA/yXouwQIaAAAAADp4P////8l7LsECGgIAAAA
6dD/////JfC7BAhoEAAAAOnA/////yX0uwQIaBgAAADpsP////8l+LsECGggAAAA6aD/////Jfy7
BAhoKAAAAOmQ/////yUAvAQIaDAAAADpgP////8lBLwECGg4AAAA6XD/////JQi8BAhoQAAAAOlg
/////yUMvAQIaEgAAADpUP////8lELwECGhQAAAA6UD/////JRS8BAhoWAAAAOkw/////yUYvAQI
aGAAAADpIP////8lHLwECGhoAAAA6RD/////JSC8BAhocAAAAOkA/////yUkvAQIaHgAAADp8P7/
//8lKLwECGiAAAAA6eD+////JSy8BAhoiAAAAOnQ/v///yUwvAQIaJAAAADpwP7///8lNLwECGiY
AAAA6bD+////JTi8BAhooAAAAOmg/v///yU8vAQIaKgAAADpkP7///8lQLwECGiwAAAA6YD+////
JUS8BAhouAAAAOlw/v///yVIvAQIaMAAAADpYP7///8lTLwECGjIAAAA6VD+////JVC8BAho0AAA
AOlA/v///yVUvAQIaNgAAADpMP7///8lWLwECGjgAAAA6SD+////JVy8BAho6AAAAOkQ/v///yVg
vAQIaPAAAADpAP7///8lZLwECGj4AAAA6fD9////JWi8BAhoAAEAAOng/f///yVsvAQIaAgBAADp
0P3///8lcLwECGgQAQAA6cD9////JXS8BAhoGAEAAOmw/f///yV4vAQIaCABAADpoP3///8lfLwE
CGgoAQAA6ZD9//8x7V6J4YPk+FBUUmgMqAQIaACLBAhRVmiMpQQI6N/+///0kJCQkJCQkJCQkJCQ
kJBVieWDPWi6BAgAdTjrD4n2jVAEiRVkugQIiwD/0KFkugQIgzgAdem4IIwECIXAdApoyLsECOgW
/v//xwVougQIAQAAAMnDifZVieXJw412AFWJ5biAiwQIhcB0D2hEvQQIaMi7BAjoRf3//8nDjXYA
VYnlycOQkJCQkJCQkJCQkFWJ5YHsOAEAAFdWi0UIiYVg////i4Vg////i1AMhdJ0AusN6Ij9///r
6o22AAAAAIuFYP///8dACAEAAABqAGoAagChdKgECFBqAehA/f//g8QUicCJhWT///+DvWT/////
dQ1ogKgECOjGGAAAg8QE6wXpiwIAAGiUAAAAjYVs////UKGguwQIUOix/v//g8QMicCJhWT///+D
vWT/////dRvoJBQAAInAicKDOgR0DWiNqAQI6HkYAACDxASDvWT///8AdBmDvWT/////dRLo9xMA
AInAicKDOgR0AusC64+BvWT///+UAAAAdA1omKgECOg8GAAAg8QEx4Vo////AAAAAIuFbP///4XA
dBGD+AEPhHgBAADplQEAAI12AKGAugQIicKNBJUAAAAAumC7BAiNDBCJjVz///9qYOhd/P//g8QE
icCJwouFXP///4kQi4Vc////gzgAdQ1opqgECOjNFwAAg8QEamCLhVz///+LEFLoFv3//4PECIuF
XP///4sQi4Vw////jXoEicb8uQkAAADzpYuFXP///4sQi4Vc////iwiDwSyJSiiLhXT///+Jhcj+
//+LhXj///+Jhcz+//9ogAAAAI2FyP7//41QEFKNhWz///+NUBRS6Iz7//+DxAzHhdT+//8AAAAA
i4XU/v//iYXQ/v//jYXI/v//UGgRDwAAi4Vw////i1AcUmhgkQQI6NP6//+DxBCJwImFWP///4O9
WP////91E+iWEgAAicCJwosCiYVo////62+LhVz///+LEIuFWP///4kCi4V8////i5Vc////iRD/
BYC6BAjHhdT+//8BAAAAi4XQ/v//hcB0BOsJifboK/v//+vr6ymNtCYAAAAAoSDAFAiFwHQXgz14
qAQIAH4OoXioBAhQ6LP7//+DxATrAJBqBI2FaP///1ChrLsECFDoefr//4PEDInAiYVk////g71k
/////3UNaLSoBAjoTxYAAIPEBIO9ZP///wR0DWjAqAQI6DkWAACDxATpbv3//42lwP7//15fycON
dgBVieWB7KgBAABTi0UIiUX8i0X8i1AEiVX4i0X8ixCJVfRqAGoAagChdKgECFBqAehM+v//g8QU
icCJhVz///+DvVz/////dQ1ogKgECOjSFQAAg8QEaIAAAACNhdz+//9Qi0X8g8AQUOjz+f//g8QM
i0X8i1AMhdJ0BusLjXQmAOgb+v//6+mLRfzHQAgBAAAAx4Vg////AQAAAGiUAAAAjYVg////UKGk
uwQIUOh++f//g8QMicCJhVz///+DvVz/////dQ1oz6gECOhUFQAAg8QEgb1c////lAAAAHQNaMCo
BAjoOxUAAIPEBI10JgBqBI2FWP7//1ChqLsECFDoLPv//4PEDInAiYVc////g71c/////3Ub6J8Q
AACJwInCgzoEdA1o26gECOj0FAAAg8QEg71c/////3UY6HsQAACJwInCgzoEdQrHhVz///8AAAAA
g71c////AHUD6x6Qg71c////BHQUi4Vc////UGjmqAQI6KoUAACDxAiDvVz///8AdALrCOlj////
jXYAoSDAFAiFwHRAgz14qAQIAH43jYVc/v//UGoAagLofvn//4PEDKFwqAQIUI2FXP7//1DoWfr/
/4PECI2FXP7//1Do2vn//4PEBGoCjYXc/v//UOg5+f//g8QIagCNhdz+//9QagLoNvn//4PEDItF
+FCLXfT/04PEBInCidDrAZCLnVT+///Jw1WJ5YHsFAEAAIM9hLoECAAPhIIAAADozff//4nAiYXw
/v//x4Xs/v//AAAAAIuF7P7//zsFgLoECH0ji4Xs/v//icKNBJUAAAAAumC7BAiLBBCLEDuV8P7/
/3UE6wDrCP+F7P7//+vFi4Xs/v//OwWAugQIdRLoHQUAADHA6aoDAACNtgAAAACLlez+//+J0OmX
AwAAjXYAxwWEugQIAQAAAKFguwQIg8AEUOi0BQAAg8QE6DD3//+JwIsVYLsECIkC6BH3///HhfT+
///YngQIjYX0/v//jVAEUuh4+P//g8QEx4V4////AAAAAGoAjYX0/v//UKF4qAQIUOj3+P//g8QM
x4X0/v//4J4ECI2F9P7//41QBFLoO/j//4PEBMeFeP///wAAAABqAI2F9P7//1ChcKgECFDouvj/
/4PEDMeF9P7//0CfBAiNhfT+//+NUARS6P73//+DxATHhXj///8AAAAAagCNhfT+//9QoXSoBAhQ
6H34//+DxAzHhfT+//+koAQIjYX0/v//jVAEUujB9///g8QEx4V4////AAAAAGoAjYX0/v//UKF8
qAQIUOhA+P//g8QMx4X0/v//QJ8ECI2F9P7//41QBFLohPf//4PEBKF0qAQIUI2F9P7//41QBFLo
HPf//4PECMeFeP///wAAAABqAI2F9P7//1BqD+jv9///g8QMx4X0/v//QJ8ECI2F9P7//41QBFLo
M/f//4PEBKF0qAQIUI2F9P7//41QBFLoy/b//4PECMeFeP///wAAAABqAI2F9P7//1BqAuie9///
g8QMx4X0/v//NKAECI2F9P7//41QBFLo4vb//4PEBMeFeP///wAAAABqAI2F9P7//1BqEehl9///
g8QMx4X0/v//9KAECI2F9P7//41QBFLoqfb//4PEBKF0qAQIUI2F9P7//41QBFLoQfb//4PECKF8
qAQIUI2F9P7//41QBFLoKfb//4PECGoRjYX0/v//jVAEUugV9v//g8QIx4V4////AAAAQGoAjYX0
/v//UGoG6Oj2//+DxAzHhfT+///0oAQIjYX0/v//jVAEUugs9v//g8QEoXSoBAhQjYX0/v//jVAE
UujE9f//g8QIoXyoBAhQjYX0/v//jVAEUuis9f//g8QIahGNhfT+//+NUARS6Jj1//+DxAjHhXj/
//8AAABAagCNhfT+//9QagPoa/b//4PEDI1FgFDov/X//4PEBKFwqAQIUI1FgFDoXfX//4PECGoA
jUWAUGoA6F31//+DxAyNRYBQ6JH1//+DxASheKgECFCNRYBQ6C/1//+DxAihdKgECFCNRYBQ6B31
//+DxAhqD41FgFDoD/X//4PECGoCjUWAUOgB9f//g8QIahGNRYBQ6PP0//+DxAhqAI1FgFBqAejz
9P//g8QMMcDrAMnDifZVieWB7BQBAACDPaC7BAj/dAbpTwEAAJBooLsECOhG9P//g8QEicCJRfyD
ffz/dQ1o+KgECOiiDwAAg8QEaKi7BAjoIfT//4PEBInAiUX8g338/3UNaPioBAjofQ8AAIPEBMeF
bP///wAAAADHhXD///8AAAAAx4V4////AAAAAIuFeP///4mFdP///42FbP///1BoEQ8AAGhQvhQI
aFCOBAjo8fL//4PEEInAiUX8g338/3UNaAOpBAjoHQ8AAIPEBMcFZLsECAC7BAihZLsECIPABFDo
WgEAAIPEBKFkuwQIi1X8iRD/BYC6BAjHhXj///8BAAAAkIuFdP///4XAdAbrC410JgDoS/P//+vp
oSDAFAiFwHROgz14qAQIAH5FoXioBAhQ6Nzz//+DxASNhez+//9QagBqAuip8///g8QMoXCoBAhQ
jYXs/v//UOiE9P//g8QIjYXs/v//UOgF9P//g8QEycNVieWD7ASQx0X8AgAAAIn2i0X8OwWAugQI
fAXrVI12AItF/InCjQSVAAAAALpguwQIgzwQAHQ1i0X8icKNBJUAAAAAumC7BAiLBBBQ6L/z//+D
xASLRfyJwo0ElQAAAAC6YLsECMcEEAAAAAD/Rfzrn6FguwQIxwAAAAAAxwVkuwQIAAAAAMcFgLoE
CAEAAADHBYS6BAgAAAAAxwWkuwQI/////8cFoLsECP/////HBay7BAj/////xwWouwQI/////+ih
+f//ycONdgBVieVqJItFCFDo9vL//4PECItFCMdAEAAAAACLRQjHAAAAAACLRQjHQAQAAAAAi0UI
x0AIAAAAAItFCMdADAEAAACLRQjHQBAAAAAAi0UIx0AUAAAAAItFCMdAHAAAAACLRQjHQBgAAAAA
i0UIx0AgAAAAADHA6wDJw4n2VYnli0UMhcB0DoP4AXQZ6x6NtCYAAAAAi0UIi1UMiVAQMcDrE412
ALhfAAAA6wm4FgAAAOsCifbJw4n2VYnli0UIi1UMiVAci0UIx0AYAQAAADHA6wKJ9snDifZVieWB
fQz/PwAAdwe4FgAAAOsNi0UIi1UMiVAgMcDrAMnDifZVieWB7KAAAACLRQiJRfzojPj//+i3/P//
g30MAHUKuBYAAADpbwEAAItFDIN4GAB1CrgWAAAA6VwBAACDPYC6BAgPfgq4CwAAAOlJAQAAx4Vo
////AAAAAItFDImFbP///4tFEImFcP///4tFFImFdP///4tF/ImFeP///42FaP///41QFFJqAGoC
6Cjx//+DxAxolAAAAI2FaP///1ChpLsECFDoDvD//4PEDInAiYVg////g71g/////3UNaM+oBAjo
5AsAAIPEBIG9YP///5QAAAB0DWjAqAQI6MsLAACDxASNdCYAagSNhWT///9Qoai7BAhQ6Lzx//+D
xAyJwImFYP///4O9YP////91G+gvBwAAicCJwoM6BHQNaNuoBAjohAsAAIPEBIO9YP////91GOgL
BwAAicCJwoM6BHUKx4Vg////AAAAAIO9YP///wB1A+sekIO9YP///wR0FIuFYP///1Bo5qgECOg6
CwAAg8QIg71g////AHQC6wjpY////412AIuVZP///4nQ6waNtgAAAADJw4n2VYnlg+wIi0UIiUX8
6PP2//+LRQxQi0X8ixCLAlDoyvD//4PECInAiUX4g334/3UR6HMGAACJwInCiwqJyOsN6wsxwOsH
jbQmAAAAAMnDifZVieWD7AToqfb//4nAiUX8g338AHwNi0X8OwWAugQIfQLrHmgXqQQIaPICAABo
QKkECGiAqQQI6LDu//+DxBDrAItF/InCjQSVAAAAAInCgcJguwQIidDrA412AMnDifZVieWLRRBQ
i0UMUItFCFDoWO///4PEDInAg/j/dRHo1QUAAInAicKLConI6wbrBDHA6wDJw412AFWJ5YHslAAA
AFdWU4N9DAB0R4tFDI29dP///4nG/LkjAAAA86WLRQyDOAF0HotFDIM4AHQWg30IAH4Qg30IP38K
x4V0////YJ4ECI2NdP///4mNcP///+sKx4Vw////AAAAAItFEFCLhXD///9Qi0UIUOid7///g8QM
icCD+P91B7j/////62+DfQgAfmWDfQg/f1+DfRAAdC6LRRCLVQiJlWz///+LjWz///+NFI0AAAAA
x4Vs////YL0ECIuNbP///4sUCokQg30MAHQli0UIicKNBJUAAAAAumC9BAiLTQyJjWz///+LjWz/
//+LGYkcEDHA6wCNpWD///9bXl/Jw4n2VYnlg+wIVlPoV/7//4lF/ItF/IsQi0IoiUX4i0X8ixCL
RfyLMIPGMIlyKItFCInCjQSVAAAAALpgvQQIgzwQAHQdi0UIicKNBJUAAAAAumC9BAiLTQhRixwQ
/9ODxASLRfyLEItF/Iswg8YsiXIojWXwW17Jw4n2VYnlycONdgBVieXJw412AFWJ5YPsBOht7P//
icCJRfyLRQijsLsECIM9gLoECAB0DqFguwQIi1X8OxB0AusQoXSoBAhQ6B4AAACDxATrFqF0qAQI
UKFguwQIixBS6Cbu//+DxAjJw5BVieWD7AzoFez//4nAiUX4gz2AugQIAHUXobC7BAhQ6Izt//+D
xATrJ420JgAAAAChYLsECIsQO1X4dBShsLsECFDoqe3//4PEBI22AAAAAKFguwQIixA7Vfh0JGik
qQQIaIMDAABoQKkECGjAqQQI6Pvr//+DxBDrBo22AAAAAIsNgLoECEmJTfyNtgAAAACDffwAfwLr
SotF/InCjQSVAAAAALpguwQIiwQQixCJVfSLRfyJwo0ElQAAAAC6YLsECIsEEMcAAAAAAKF0qAQI
UItF9FDoRu3//4PECP9N/OuuobC7BAhQ6MPs//+DxATJw4n2VYnlg+wM6CHr//+JwIlF/GgAAACA
jUX4UGr/6Pzr//+DxAyJwIlF9KG0uwQIO0X8dQLrOIM9gLoECAB0D6FguwQIixA7Vfx0A+sRkGoB
6Gns//+DxATrFI10JgBqAeiZ7P//g8QEjbYAAAAAycOJ9lWJ5YPsBOix6v//icCJRfyDPYC6BAgA
dBOhYLsECItV/DsQdAfrFZCNdCYAagHoGez//4PEBOsUjXQmAGoB6Ens//+DxASNtgAAAADJw4n2
VYnlgeygAAAA6F7q//+JwIlF/GoAagBqAGoAagHoyur//4PEFItF/KO0uwQIgz2AugQIAA+OigAA
AKFguwQIi1X8OxB1fosNgLoECEmJjWT///+DvWT///8BfwLrYYuFZP///4nCjQSVAAAAALpguwQI
iwQQixCJlWD///+hfKgECFCLhWD///9Q6N3r//+DxAjHhWj///8AAAAAx4Vs////gLLmDmoAjYVo
////UOjI6f//g8QI/41k////65TpHAEAAIM9gLoECAEPjssAAAChZLsECItV/DsQD4W7AAAAiw2A
ugQISYmNZP///4O9ZP///wF/BetkjXYAi4Vk////icKNBJUAAAAAumC7BAiLBBCLEImVYP///6F8
qAQIUIuFYP///1DoP+v//4PECMeFaP///wAAAADHhWz///+AsuYOagCNhWj///9Q6Crp//+DxAj/
jWT////rkaF8qAQIUKFguwQIixBS6Pzq//+DxAjHhWj///8AAAAAx4Vs////gLLmDmoAjYVo////
UOjn6P//g8QI60aJ9oM9gLoECAB+O6F8qAQIUKFguwQIixBS6LTq//+DxAjHhWj///8AAAAAx4Vs
////AGXNHWoAjYVo////UOif6P//g8QIx4Vw////AAAAAI2FcP///41QBFLo4+n//4PEBMdF9AAA
AABqAI2FcP///1CLRQhQ6FP6//+DxAyLRQhQ6Jvp//+DxATJw4n2VYnlg+wE6J35//+JRfyLRfyL
EItKKInI6wDJw1WJ5YPsBOiB+f//iUX8i0X8ixCLSjSJyOsAycNVieWD7AToZfn//4lF/IN9CAh2
DWjpqQQI6BIEAACDxASLVfyLAotVCInRjRSNAAAAAIPAPItNDIkMAjHA6wDJw412AFWJ5YPsBOgh
+f//iUX8g30ICHYNaOmpBAjozgMAAIPEBItV/IsCi1UIidGNFI0AAAAAg8A8ixQCidDrAMnDifZV
ieUxwOsBkMnDifZVieUxwOsFkI10JgDJw4n2VYnlMcDrBZCNdCYAycOJ9lWJ5YtFCMdAFAAAAAAx
wOsAycOQVYnlg+wMx0X8AAAAAItFCIPAFFDoowAAAIPEBInAhcB1Bus5jXQmAIN9/GN/Cui15///
/0X86yPHRfQAAAAAx0X4gIQeAGoAjUX0UOgH5///g8QIx0X8AAAAAOuwMcDrB420JgAAAADJw4n2
VYnli0UIx0AUAAAAADHA6wDJw5BVieWLRQiDwBRQ6C0AAACDxASJwIXAdBC4EAAAAOsN6wuNtCYA
AAAAMcDrAMnDifZVieUxwOsBkMnDifZVieWD7ASLRQiLVQi5AQAAAIcIiU38i1X8idDrAMnDkFWJ
5YsVwLsECInQ6wDJw5BVieWLFcS7BAiJ0OsAycOQVYnlgz3AuwQI/3QQocC7BAg7BcS7BAh/A+sI
kLj/////6ymDfQgAdBOhwLsECP8FwLsECOsRjbYAAAAAocS7BAj/DcS7BAiJwOsBkMnDifZVieVq
CWoA6GDm//+DxAjJw412AFWJ5WoJagDoTOb//4PECMnDjXYAVYnlgezMAAAAx4U0////AgAAAIN9
CAJ1GYtFDIPABIsQUuhN5///g8QEicCJhTT////ojeX//8dFxAAAAACNtgAAAACLRcQ7hTT///98
BemQAAAAjUXMUOjz8///g8QEaAAAAgDo+uX//4PEBInAiUXIi0XIBfD/AQBQi0XEUGj3qQQIoUC9
BAhQ6IXl//+DxBCLRcgF8P8BAFCNRcxQ6GT0//+DxAiLRcRQaISmBAiNRcxQjUXwUOiP9P//g8QQ
icCJRfyDffz/dQ1oCqoECOgjAQAAg8QE/0XE6WT///+NdCYAi0XEUOgLAAAAg8QEMcDrAMnDifZV
ieWD7DyLRQiJRfyLRfyJwo0ElQAAAAC6AMAUCI1N/IkMEGoMjUXEUOgu5v//g8QIaAAAAgDoMeX/
/4PEBInAicKJVcTHRcwAAAIAagCNRcRQ6GXm//+DxAiJwIP4/3UNaCKqBAjolQAAAIPEBItF/InC
jQSVAAAAALpgvhQIxwQQAAAAAGg1qgQIaDeqBAjoN+b//4PECInAiUX46Drk//+JwFBoQaoECGoe
jUXUUOiH5f//g8QQjUXUUOgr5f//g8QEicBQjUXUUGoC6Drk//+DxAyNtCYAAAAA6wLrHItF/InC
jQSVAAAAALpgvhQI/wQQ6+aNtgAAAADJw4n2VYnlg+wEjUUMiUX8oUC9BAhQaFCqBAjowOT//4PE
CItF/FCLRQhQoUC9BAhQ6Irk//+DxAyhQL0ECFBoWKoECOiX5P//g8QI6F/k///Jw5CQkJCQkJCQ
kJCQkJBVieVTu8y7BAiDPcy7BAj/dAyLA//Qg8P8gzv/dfSLXfzJw5BVieXJw5CQkFWJ5VPoAAAA
AFuBw8cTAADor+X//4td/MnDAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADAAAAAQACAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAABAAAAAEAAAAAAAAAAAAAAAgAAAAIQAAACIAAAAjAAAAcHJjdGwg
ZmFpbGVkAGNhbid0IHJlYWQAYmFkIHJlYWQgc2l6ZQBtYWxsb2MgZmFpbGVkAGNhbid0IHdyaXRl
AGJhZCB3cml0ZSBzaXplAHdyaXRlIGVycm9yAHJlYWQgZXJyb3IAYmFkIHJlYWQgc2l6ZTogJWQA
Y2FuJ3QgcGlwZQBjYW4ndCBjbG9uZSBtYW5hZ2VyAHB0aHJlYWRfc2VsZgAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAcDQvb250YXAvbWFpbl9jbGVhbi9wcm9kL3NpbS9saW51eC9zay1vc2Rl
cC9mYWtlX3B0aHJlYWQuYwAAAAAAAGkgPj0gMCAmJiBpIDwgX19wdGhyZWFkX2hhbmRsZXNfbnVt
AF9fcHRocmVhZF9oYW5kbGVfc2lnY2FuY2VsAABfX3B0aHJlYWRfaGFuZGxlc1swXS5kZXNjci0+
cGlkID09IG15cGlkAGtleSB0b28gbGFyZ2UAdGhlYWQgJWQgc3RhY2sgJXAKAHB0aHJlYWRfY3Jl
YXRlIDAgZmFpbGVkAHNpZ2FsdHN0YWNrIGZhaWxlZAB3AC9kZXYvbnVsbABwcm9jICVkIHN0YXJ0
CgBQQU5JQzogAAoAAAAAAAAAAAAAANi7BAgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAADMugQIAAAAAAAAAADQugQIAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAsuwQIAAAAAAAA
AAAwuwQIAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKC6BAgAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAD/////
////////////////AAAAAAAAAABUowQImKMECCMAAAA/AAAAAAAAAP////8AAAAA/////wAAAACE
vAQIAAAAAAAAAABGiwQIVosECGaLBAh2iwQIhosECJaLBAimiwQItosECMaLBAjWiwQI5osECPaL
BAgGjAQIFowECCaMBAg2jAQIRowECFaMBAhmjAQIdowECIaMBAiWjAQIpowECLaMBAjGjAQI1owE
COaMBAj2jAQIBo0ECBaNBAgmjQQINo0ECEaNBAhWjQQIZo0ECHaNBAiGjQQIlo0ECAAAAAABAAAA
EAAAAAwAAAAAiwQIDQAAAAyoBAgEAAAAKIEECAUAAABMhgQIBgAAAKyCBAgKAAAAvAIAAAsAAAAQ
AAAAFQAAAAAAAAADAAAA3LsECAIAAAAwAQAAFAAAABEAAAAXAAAA0IkECBEAAADAiQQIEgAAABAA
AAATAAAACAAAAP7//2+QiQQI////bwEAAADw//9vHIkECAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAEAAAAAAMEFaVoAAAgAAABkAAAAxI0ECAEAAABkAAAAxI0ECCsAAAA8AAAA
AAAAADoAAACAAAAAAAAAAGkAAACAAAAAAAAAAIMAAACAAAAAAAAAALcAAACAAAAAAAAAAO8AAACA
AAAAAAAAACwBAACAAAAAAAAAAHgBAACAAAAAAAAAAMQBAACAAAAAAAAAAOoBAACAAAAAAAAAABQC
AACAAAAAAAAAADoCAACAAAAAAAAAAF8CAACAAAAAAAAAAHkCAACAAAAAAAAAAJQCAACAAAAAAAAA
ALUCAACAAAAAAAAAAO4CAACAAAAAAAAAABEDAACAAAAAAAAAADUDAACAAAAAAAAAAF8DAACAAAAA
AAAAAHMDAACCAAAAAAAAAI0DAACCAAAAAAAAAAAAAACiAAAAAAAAAMUDAACCAAAAAAAAANoDAACC
AAAAAAAAAOwDAACCAAAAAAAAAAIEAACCAAAAAAAAABkEAACCAAAAAAAAAAAAAACiAAAAAAAAAAAA
AACiAAAAAAAAAAAAAACiAAAAAAAAAC0EAACCAAAAAAAAAAAAAACiAAAAAAAAAG4EAACCAAAAAAAA
AIIEAACCAAAAHZYAAC0EAADCAAAAAAAAAJUEAACAAAAAAAAAAOQEAACAAAAAAAAAABkFAACAAAAA
AAAAAFkFAACAAAAAAAAAAJYFAACAAAAAAAAAANAFAACAAAAAAAAAAAYGAACAAAAAAAAAAD0GAACA
AAAAAAAAAHQGAACAAAAAAAAAAKYGAACCAAAAAAAAALsGAACCAAAAKDsAAM8GAACAAAAAAAAAAC0H
AACAAAAAAAAAAHMHAACAAAAAAAAAAJMHAACAACQAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAA
AAAAAACiAAAAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAA
AAAAALUHAACCAAAAQhgAANwHAACCAAAA2j8BAC0EAACCAAAA2AQAAAQIAACAAKoAAAAAAAAAAACi
AAAAAAAAABkIAACAACAAAAAAADEIAACAACEAAAAAAEkIAACAACIAAAAAAF8IAACAACMAAAAAAHYI
AACAACUAAAAAAI8IAACAACYAAAAAAKYIAACAADEAAAAAAL4IAACAADIAAAAAANcIAACAADMAAAAA
AO8IAACAADQAAAAAAAkJAACAADUAAAAAACIJAACAADYAAAAAADwJAACAADgAAAAAAFUJAACAADkA
AAAAAG8JAACAADsAAAAAAJIJAACAAD0AAAAAAKoJAACAAD4AAAAAAMIJAACAAD8AAAAAANoJAACA
AEAAAAAAAPIJAACAAEEAAAAAAAsKAACAAEIAAAAAACUKAACAAEMAAAAAADwKAACAAEQAAAAAAFUK
AACAAEUAAAAAAGwKAACAAEYAAAAAAIUKAACAAEcAAAAAAJ0KAACAAEgAAAAAALgKAACAAEkAAAAA
AM8KAACAAE4AAAAAABILAACAAFEAAAAAACsLAACAAFIAAAAAAEULAACAAFMAAAAAAF0LAACAAFQA
AAAAAHYLAACAAFYAAAAAAI8LAACAAFkAAAAAAKgLAACAAG8AAAAAAPULAACAAHIAAAAAAAwMAACA
AHUAAAAAACcMAACAAHsAAAAAAEEMAACAAHwAAAAAAF4MAACAAH8AAAAAAHsMAACAAIAAAAAAAJoM
AACAAIMAAAAAALcMAACAAIQAAAAAANYMAACAAIcAAAAAAPAMAACAAIoAAAAAAAsNAACAAI0AAAAA
ACcNAACAAI4AAAAAAEQNAACAAJEAAAAAAF4NAACCAAAAVU8BAJINAACCAAAAiA8AALoNAACAAAAA
AAAAAAAAAACiAAAAAAAAAO4NAACAAAAAAAAAADcOAACAACIAAAAAAHYOAACAAAAAAAAAALIOAACA
AAAAAAAAAOgOAACAAAAAAAAAABoPAACAAAAAAAAAAFMPAACAADMAAAAAAJEPAACAAAAAAAAAAMkP
AACAADsAAAAAAOQPAACAAEIAAAAAAB8QAACAAEUAAAAAADwQAACAAAAAAAAAAHoQAACAAAAAAAAA
AKkQAACAAFIAAAAAANcQAACAAFkAAAAAABcRAACAAF0AAAAAADURAACAAAAAAAAAAIQRAACAAAAA
AAAAAL8RAACAAAAAAAAAAPkRAACAAAAAAAAAABUSAACAAGsAAAAAADcSAACAAAAAAAAAAHcSAACA
AHMAAAAAAI8SAACAAHgAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAAAC0EAACCAAAAEQoAAKgS
AACAAP8AAAAAAL4SAACAABgBAAAAAAAAAACiAAAAAAAAANMSAACAACMAAAAAAOwSAACAACQAAAAA
AAUTAACAACUAAAAAAB8TAACAACYAAAAAAAAAAACiAAAAAAAAADkTAAAgACIAAAAAAAAAAABkAAAA
xI0ECE8TAABkAAAAUI4ECFcTAABkAAAAUI4ECCsAAAA8AAAAAAAAADoAAACAAAAAAAAAAGkAAACA
AAAAAAAAAIMAAACAAAAAAAAAALcAAACAAAAAAAAAAO8AAACAAAAAAAAAACwBAACAAAAAAAAAAHgB
AACAAAAAAAAAAMQBAACAAAAAAAAAAOoBAACAAAAAAAAAABQCAACAAAAAAAAAADoCAACAAAAAAAAA
AF8CAACAAAAAAAAAAHkCAACAAAAAAAAAAJQCAACAAAAAAAAAALUCAACAAAAAAAAAAO4CAACAAAAA
AAAAABEDAACAAAAAAAAAADUDAACAAAAAAAAAAF8DAACAAAAAAAAAAGYTAACCAAAA1BAAAHsTAACC
AAAAAAAAAJMTAACCAAAAAAAAAAAAAACiAAAAAAAAAKwTAACCAAAAAAAAAAAAAACiAAAAAAAAAAAA
AACiAAAAAAAAAC0EAADCAAAA2AQAAMUTAACCAAAAUgkAAAYUAACAAEYAAAAAAAAAAACiAAAAAAAA
ACoUAACCAAAA50EBAC0EAADCAAAAAAAAAEQUAACAACAAAAAAAFsUAACAACEAAAAAAHIUAACAACIA
AAAAAIcUAACAACMAAAAAAJ0UAACAACUAAAAAALUUAACAACYAAAAAAMsUAACAADEAAAAAAOIUAACA
ADIAAAAAAPoUAACAADMAAAAAABEVAACAADQAAAAAACoVAACAADUAAAAAAEIVAACAADYAAAAAAFsV
AACAADgAAAAAAHMVAACAADkAAAAAAIwVAACAADsAAAAAAKwVAACAAD0AAAAAAMIVAACAAD4AAAAA
ANgVAACAAD8AAAAAAO4VAACAAEAAAAAAAAQWAACAAEEAAAAAABsWAACAAEIAAAAAADMWAACAAEMA
AAAAAEkWAACAAEQAAAAAAGAWAACAAEUAAAAAAHYWAACAAEYAAAAAAI4WAACAAEcAAAAAAKUWAACA
AEgAAAAAAL4WAACAAEkAAAAAANMWAACAAE4AAAAAABMXAACAAFEAAAAAACsXAACAAFIAAAAAAEsX
AACAAFMAAAAAAGIXAACAAFQAAAAAAHoXAACAAFYAAAAAAJIXAACAAFkAAAAAAKoXAACAAG8AAAAA
APUXAACAAHIAAAAAAAsYAACAAHUAAAAAACUYAACAAHsAAAAAAD4YAACAAHwAAAAAAFkYAACAAH8A
AAAAAHQYAACAAIAAAAAAAJEYAACAAIMAAAAAAKwYAACAAIQAAAAAAMkYAACAAIcAAAAAAOEYAACA
AIoAAAAAAPoYAACAAI0AAAAAABUZAACAAI4AAAAAADEZAACAAJEAAAAAAAAAAACiAAAAAAAAAEoZ
AACAADAAAAAAAGgZAACCAAAAIPAAAH0ZAACCAAAAQhgAAC0EAADCAAAAEQoAAJYZAACAACMAAAAA
AK8ZAACAACQAAAAAAMgZAACAACUAAAAAAOIZAACAACYAAAAAAAAAAACiAAAAAAAAAMUTAACCAAAA
AAAAAAAAAACiAAAAAAAAAPwZAACAAKQAAAAAABUaAACAAAAAAAAAAF0aAACAAAAAAAAAAHAaAACA
AAAAAAAAALIaAACAAAAAAAAAAOkaAACAAAAAAAAAACQbAACAAAAAAAAAAF0bAACAAAAAAAAAAJUb
AACAAAAAAAAAANAbAACAAAAAAAAAABEcAACAAAAAAAAAAEMcAACAAAAAAAAAAHocAACAAAAAAAAA
AL4cAACAAAAAAAAAAAAdAACAAPAAAAAAABYdAACAAAcBAAAAADkdAACAABABAAAAAF4dAACAABgB
AAAAAIEdAACAABsBAAAAAAAAAACiAAAAAAAAAKUdAACAAD0AAAAAALodAACCAAAAAAAAAAAAAACi
AAAAAAAAANgdAACAAN0BAAAAAAAAAACiAAAAAAAAAMUTAACCAAAAOQUAAOwdAACAALUAAAAAAAAA
AACiAAAAAAAAAAIeAACCAAAAAAAAAC0EAADCAAAAAAAAAAAAAACiAAAAAAAAABgeAACCAAAAfwUA
AC4eAACCAAAAAAAAAAAAAACiAAAAAAAAAEweAACAAMEAAAAAAC0EAADCAAAAAAAAAGMeAACCAAAA
sFIDAIAeAACAAAAAAAAAALweAACAAAAAAAAAAOseAACAAAAAAAAAACIfAACAAAAAAAAAAFEfAACA
AAAAAAAAAHofAACAAAAAAAAAALMfAACAAAAAAAAAAOcfAACAAAAAAAAAABwgAACAAAAAAAAAAFAg
AACAAAAAAAAAAI0gAACAAAAAAAAAAMcgAACAAAAAAAAAAAYhAACAAAAAAAAAAE4hAACAAAAAAAAA
AI8hAACAAAAAAAAAAM0hAACAAAAAAAAAAP8hAACAAAAAAAAAAD8iAACAAAAAAAAAAHciAACAAAAA
AAAAALoiAACAAAAAAAAAAPgiAACAAAAAAAAAADcjAACAAAAAAAAAAGojAACAAAAAAAAAAKEjAACA
AAAAAAAAAM8jAACAAAAAAAAAAAAkAACAAAAAAAAAAD0kAACAAAAAAAAAAIEkAACAAAAAAAAAALQk
AACAAAAAAAAAAOskAACAAAAAAAAAAC8lAACAAAAAAAAAAGwlAACAAAAAAAAAAKAlAACAAAAAAAAA
ANwlAACAAAAAAAAAABsmAACAAAAAAAAAAFUmAACAAAAAAAAAAJkmAACAAAAAAAAAANEmAACAAAAA
AAAAABMnAACAAAAAAAAAAE8nAACAAAAAAAAAAIQnAACAAAAAAAAAAL0nAACAAAAAAAAAAPInAACA
AAAAAAAAACUoAACAAAAAAAAAAFkoAACAAAAAAAAAAJEoAACAAAAAAAAAAMcoAACAAAAAAAAAAP4o
AACAAAAAAAAAADcpAACAAAAAAAAAAG4pAACAAAAAAAAAAKMpAACAAAAAAAAAAOwpAACAAAAAAAAA
ACQqAACAAAAAAAAAAAAAAACiAAAAAAAAADwqAACCAAAAAAAAAAAAAACiAAAAAAAAAC0EAACCAAAA
CQYAAFIqAACAAHYAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAAAGoqAACCAAAAZjIAAIAqAACC
AAAAEhgAAJsqAACAABcAAAAAALgqAACAAB8AAAAAAAAAAACiAAAAAAAAAP8qAACAACkAAAAAABsr
AACAADEAAAAAADMrAACCAAAAAAAAAAAAAACiAAAAAAAAAE4rAACAAEcAAAAAAHwrAACAALcAAAAA
AJErAACCAAAAiA8AAKUrAACAAAAAAAAAAAAAAACiAAAAAAAAAOArAACCAAAAZbYBAPwrAACAAAAA
AAAAADksAACAACEAAAAAAFEsAACAAAAAAAAAAJAsAACAAAAAAAAAAOAsAACAAAAAAAAAAB8tAACA
AAAAAAAAAF8tAACAAAAAAAAAAJYtAACAAAAAAAAAANwtAACAAAAAAAAAAB4uAACAAAAAAAAAAG0u
AACAAAAAAAAAALcuAACAAF4AAAAAANEuAACAAAAAAAAAAAUvAACAAAAAAAAAACkvAACAAAAAAAAA
AF4vAACAAAAAAAAAAIcvAACAAAAAAAAAAKMvAACAAAAAAAAAANgvAACAAAAAAAAAAAEwAACAAAAA
AAAAAB0wAACAAAAAAAAAAEcwAACAAAAAAAAAAHwwAACAAAAAAAAAAKQwAACAAAAAAAAAANkwAACA
AAAAAAAAAAcxAACAAAAAAAAAADUxAACAAAAAAAAAAFgxAACAAAAAAAAAAJ8xAACAAAAAAAAAAPUx
AACAAAAAAAAAADcyAACAAAAAAAAAAGAyAACAAAYBAAAAAHwyAACAAAAAAAAAAAAAAACiAAAAAAAA
ALUyAACCAAAAYzcAANMyAACAAAAAAAAAAB8zAACAAAAAAAAAAFEzAACAAAAAAAAAAAAAAACiAAAA
AAAAAKwzAACAAAAAAAAAAOszAACAAAAAAAAAAAI0AACCAAAAAAAAACE0AACCAAAAI8UAAD80AACA
AAAAAAAAAH00AACAAAAAAAAAAJQ0AACAAAAAAAAAAMg0AACAAAAAAAAAAP80AACAAAAAAAAAAFE1
AACAAAAAAAAAAGc1AACAAAAAAAAAAJ81AACAAAAAAAAAANE1AACAAAAAAAAAAAc2AACAAAAAAAAA
ADw2AACAAAAAAAAAAHE2AACAAAAAAAAAAKk2AACAAAAAAAAAAN02AACAAAAAAAAAACE3AACAAAAA
AAAAAGQ3AACAAAAAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAAAIw3AACCAAAAuTUAAKk3AACA
AAAAAAAAAOY3AACAAAAAAAAAAA04AACAAAAAAAAAAEw4AACAAAAAAAAAAGI4AACAADcAAAAAAAAA
AACiAAAAAAAAAAAAAACiAAAAAAAAAHk4AACCAAAA/2wAAC0EAADCAAAAAAAAAI84AACAAC0AAAAA
AMg4AACAADUAAAAAAAI5AACCAAAAOLIAABs5AACAACEAAAAAADA5AACAACIAAAAAAEY5AACAACMA
AAAAAFo5AACAACQAAAAAAG85AACAACUAAAAAAIQ5AACAACYAAAAAAJs5AACAACcAAAAAALE5AACA
ACoAAAAAAMc5AACAAC4AAAAAANw5AACAADoAAAAAAPI5AACAAD8AAAAAAAg6AACAAEQAAAAAAB86
AACAAEkAAAAAADc6AACAAE4AAAAAAE06AACAAGAAAAAAAGM6AACAAGUAAAAAAHg6AACAAG4AAAAA
AJA6AACAAG8AAAAAAKg6AACAAHMAAAAAAJErAACCAAAAAQUAAL46AACAAEcAAAAAAAAAAACiAAAA
AAAAAC0EAADCAAAAAAAAANQ6AACAAIEAAAAAAOk6AACAAIIAAAAAAP86AACAAIMAAAAAABM7AACA
AKkAAAAAACo7AACAAKoAAAAAAEE7AACAAKsAAAAAAFg7AACAAKwAAAAAAG87AACAAK8AAAAAAIg7
AACAALAAAAAAAKE7AACAALEAAAAAALo7AACAALIAAAAAANM7AACAALQAAAAAAO07AACCAAAAAAAA
AAM8AACCAAAAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAAAB48AACCAAAARwoAADg8AACCAAAA
AAAAAAAAAACiAAAAAAAAAIAqAACCAAAAAAAAAAAAAACiAAAAAAAAAJErAACCAAAAAAAAAAAAAACi
AAAAAAAAAFM8AACAADAAAAAAAGo8AACAADMAAAAAAAAAAACiAAAAAAAAAIA8AACCAAAAAAAAAAAA
AACiAAAAAAAAAJ08AACAAMsAAAAAALY8AACAAMwAAAAAANE8AACAAM0AAAAAAAAAAACiAAAAAAAA
AOw8AACAAAAAAAAAADE9AACAAAAAAAAAAHI9AACAAAAAAAAAAKA9AACAAAAAAAAAANo9AACAAAAA
AAAAAA0+AACAAAAAAAAAACE+AACCAAAAAAAAAC0EAADCAAAAAAAAAAAAAACiAAAAAAAAADc+AACA
AFsCAAAAAAAAAACiAAAAAAAAAGU+AACCAAAAk58EAKA+AACCAAAAAAAAALU+AACCAAAAAAAAAM8+
AACCAAAAAAAAAOo+AACCAAAAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAA
AAAAAACiAAAAAAAAAAM/AACCAAAAAAAAABw/AACCAAAAAAAAAF0/AACCAAAAAAAAABw/AADCAAAA
AAAAAKE/AACCAAAAAAAAALc/AACCAAAAAAAAANY/AACCAAAAAAAAAPQ/AACCAAAAAAAAAAAAAACi
AAAAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAAABBAAACCAAAAAAAAAAAAAACiAAAAAAAAAAAA
AACiAAAAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAAAC9AAACCAAAAAAAAAEpAAACCAAAAAAAA
AAAAAACiAAAAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAAAGNAAACCAAAAFqYAAHpAAACCAAAA
AAAAAJErAADCAAAAAAAAAI9AAACCAAAAUx4AAKlAAACAAAAAAAAAANtAAACAAAAAAAAAAAAAAACi
AAAAAAAAAAAAAACiAAAAAAAAAJErAACCAAAAGEYAAC0EAADCAAAAAAAAAA9BAACCAAAAAAAAAAAA
AACiAAAAAAAAAChBAACAADwAAAAAAD9BAACAAAAAAAAAAHRBAACAAAAAAAAAALJBAACAAAAAAAAA
APNBAACAAAAAAAAAACJCAACAAAAAAAAAAAAAAACiAAAAAAAAAEFCAACCAAAAE+wAAI9AAACCAAAA
AAAAAAAAAACiAAAAAAAAAGJCAACAAAAAAAAAAKtCAACAACIAAAAAAOpCAACAAAAAAAAAACZDAACA
AAAAAAAAAOgOAACAAAAAAAAAAFxDAACAAAAAAAAAAJRDAACAADMAAAAAAMhDAACAAAAAAAAAAABE
AACAADsAAAAAABtEAACAAEIAAAAAAFVEAACAAEUAAAAAAHJEAACAAAAAAAAAALBEAACAAAAAAAAA
AN9EAACAAFIAAAAAAA1FAACAAFkAAAAAAE1FAACAAF0AAAAAAGtFAACAAHgAAAAAAAAAAACiAAAA
AAAAAIRFAACAAAAAAAAAAMVFAACAAAAAAAAAAANGAACAAAAAAAAAAD9GAACAAAAAAAAAAIFGAACA
AAAAAAAAAKFGAACAAAAAAAAAAOFGAACAAAAAAAAAACxHAACAAAAAAAAAAFlHAACAAAAAAAAAAHdH
AACAAAAAAAAAALZHAACAAAAAAAAAAPxHAACCAAAAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAA
ABpIAACCAAAAAAAAADNIAACCAAAAAAAAAAAAAACiAAAAAAAAAAAAAACiAAAAAAAAAE5IAACCAAAA
CyUAAGZIAACCAAAAAAAAAAAAAACiAAAAAAAAAIRIAACAAAAAAAAAAMhIAACAAEQAAAAAAORIAACC
AAAAPUMAAANJAACAAAAAAAAAAFlJAACAAAAAAAAAAIhJAACAAAAAAAAAAMxJAACAAAAAAAAAAAAA
AACiAAAAAAAAAPhJAACAAAAAAAAAAB5KAACAAGgAAAAAAOArAACCAAAAAAAAAAAAAACiAAAAAAAA
AAAAAACiAAAAAAAAADZKAACCAAAAAAAAAAAAAACiAAAAAAAAAExKAACAAAAAAAAAAJhKAACAAAAA
AAAAANlKAACAAAAAAAAAABpLAACAAAAAAAAAAENLAACAAAAAAAAAAHtLAACAAAAAAAAAAK1LAACA
AAAAAAAAAOdLAACAAAAAAAAAACRMAACAAFQAAAAAAFdMAACAAFgAAAAAAJpMAACAAAAAAAAAAMBM
AACAAAAAAAAAAP1MAACAAAAAAAAAAEFNAACAAAAAAAAAAHRNAACAAGgAAAAAAMNNAACAAAAAAAAA
AANOAACAAAAAAAAAADVOAACAAHAAAAAAAGhOAAAmAI8AgLoECIVOAAAmAJAAhLoECJ1OAAAgAJkA
AAAAAL5OAAAgAKMAAAAAAN9OAAAmAK0AYLsECA5PAAAmALQAoLsECC1PAAAmALUAqLsECExPAAAm
ALcAsLsECGZPAAAmALgAtLsECIZPAAAgAL4AAAAAAKNPAAAgAL8AAAAAAMJPAAAgAMAAAAAAAOJP
AAAgAMIAAAAAAABQAAAgAMUAAAAAAB1QAAAgAMYAAAAAADlQAAAgAMcAAAAAAFRQAAAgAMgAAAAA
AHFQAAAkANQAUI4ECI9QAACgANMACAAAAGU+AACEAAAAUI4ECAAAAABEANQAAAAAAAAAAABEANUA
CwAAAAAAAABEANgACwAAAAAAAABEAN0AFAAAAAAAAABEAN4AIwAAAAAAAABEAOEAMAAAAAAAAABE
AOYAPQAAAAAAAABEAOcAWwAAAAAAAABEAOgAZAAAAAAAAABEAOoAcQAAAAAAAABEAO4AeAAAAAAA
AABEAO8AmgAAAAAAAABEAPAAsQAAAAAAAABEAPEAvgAAAAAAAABEAPIA4AAAAAAAAABEAPMA4gAA
AAAAAABEAPQA7gAAAAAAAABEAPcA+wAAAAAAAABEAPkABQEAAAAAAABEAPwAIAEAAAAAAABEAAIB
PAEAAAAAAABEAAMBUgEAAAAAAABEAAQBXQEAAAAAAABEAAUBagEAAAAAAABEAAYBfQEAAAAAAABE
AAcBmAEAAAAAAABEAAkBrgEAAAAAAABEAAoBugEAAAAAAABEAAsBxgEAAAAAAABEAAwB5wEAAAAA
AABEAA8B/QEAAAAAAABEABQBKAIAAAAAAABEABUBMQIAAAAAAABEABYBQgIAAAAAAABEABgBRAIA
AAAAAABEABoBVAIAAAAAAABEABsBYgIAAAAAAABEACABaAIAAAAAAABEACIBcgIAAAAAAABEACMB
gAIAAAAAAABEACYBhwIAAAAAAABEACcBhwIAAAAAAABEAC0BkAIAAAAAAABEAC4BogIAAAAAAABE
ADABsAIAAAAAAABEADIBsgIAAAAAAABEADUBswIAAAAAAABEADYB0gIAAAAAAABEADcB2wIAAAAA
AABEADgB6AIAAAAAAABEADkB8QIAAAAAAABEADwB/gIAAAAAAABEAD4BAwMAAAAAAABEAD4BAwMA
AJpQAACAANUAbP///6VQAACAANYAaP///69QAACAANcAZP///7hQAACAANgAYP///wAAAADAAAAA
CwAAANFQAACAAPwAXP///95QAACAAP4AWP///+hQAACAAP8AyP7//wAAAADAAAAAIAEAAAAAAADg
AAAAhwIAAAAAAADgAAAAAwMAAAAAAAAkAAAADQMAAPVQAAAkAEcBYJEECI9QAACgAEYBCAAAAAAA
AABEAEcBAAAAAAAAAABEAEgBCgAAAAAAAABEAEkBEAAAAAAAAABEAEoBGQAAAAAAAABEAFYBIQAA
AAAAAABEAFcBPwAAAAAAAABEAFgBSAAAAAAAAABEAFsBVQAAAAAAAABEAF8BcAAAAAAAAABEAGAB
gAAAAAAAAABEAGUBhwAAAAAAAABEAGoBkQAAAAAAAABEAGwBmwAAAAAAAABEAG0BvQAAAAAAAABE
AG4BxgAAAAAAAABEAG8B0wAAAAAAAABEAHAB3wAAAAAAAABEAHQB8AAAAAAAAABEAHUBDwEAAAAA
AABEAHYBJgEAAAAAAABEAHcBMwEAAAAAAABEAHgBSgEAAAAAAABEAHkBVAEAAAAAAABEAHoBXQEA
AAAAAABEAHsBYAEAAAAAAABEAHwBaQEAAAAAAABEAH0BfQEAAAAAAABEAIIBkAEAAAAAAABEAIMB
ogEAAAAAAABEAIQBtQEAAAAAAABEAIUBygEAAAAAAABEAI0B2QEAAAAAAABEAI4B6gEAAAAAAABE
AJAB/QEAAAAAAABEAJEBDwIAAAAAAABEAJEBDwIAABFRAACAAEgB/P///yFRAACAAEkB+P///zBR
AACAAEoB9P///5pQAACAAEsBYP///69QAACAAEwBXP///0BRAACAAE0B3P7//1BRAACAAE4BXP7/
/6VQAACAAE8BWP7//wAAAADAAAAACgAAAAAAAADgAAAADwIAAAAAAAAkAAAAGAIAAFxRAAAkAJsB
eJMECAAAAABEAJsBAAAAAAAAAABEAJwBCQAAAAAAAABEAJ8BCQAAAAAAAABEAKABFgAAAAAAAABE
AKMBIwAAAAAAAABEAKQBLQAAAAAAAABEAKsBaAAAAAAAAABEAK0BdgAAAAAAAABEAK4BewAAAAAA
AABEALIBiAAAAAAAAABEALMBlQAAAAAAAABEALkBmAAAAAAAAABEALoBogAAAAAAAABEALsBswAA
AAAAAABEAMEBwgAAAAAAAABEAMYBxwAAAAAAAABEAMcB0QAAAAAAAABEAMgB4wAAAAAAAABEAMkB
7QAAAAAAAABEAMsBBAEAAAAAAABEAMwBDgEAAAAAAABEAM0BIAEAAAAAAABEAM4BKgEAAAAAAABE
ANABQQEAAAAAAABEANEBSwEAAAAAAABEANIBXQEAAAAAAABEANMBZwEAAAAAAABEANUBfgEAAAAA
AABEANYBiAEAAAAAAABEANcBmgEAAAAAAABEANgBpAEAAAAAAABEANoBuwEAAAAAAABEANsBxQEA
AAAAAABEANwB1wEAAAAAAABEAN0B7wEAAAAAAABEAN4B+QEAAAAAAABEAOABDAIAAAAAAABEAOEB
FgIAAAAAAABEAOIBKAIAAAAAAABEAOMBQAIAAAAAAABEAOQBSgIAAAAAAABEAOYBXQIAAAAAAABE
AOcBZwIAAAAAAABEAOgBeQIAAAAAAABEAOkBgwIAAAAAAABEAOsBlgIAAAAAAABEAOwBoAIAAAAA
AABEAO0BsgIAAAAAAABEAO4BygIAAAAAAABEAO8B4gIAAAAAAABEAPAB9gIAAAAAAABEAPEBAAMA
AAAAAABEAPMBEwMAAAAAAABEAPQBHQMAAAAAAABEAPUBLwMAAAAAAABEAPYBRwMAAAAAAABEAPcB
XwMAAAAAAABEAPgBcwMAAAAAAABEAPkBfQMAAAAAAABEAPsBkAMAAAAAAABEAPwBnAMAAAAAAABE
AP0BrgMAAAAAAABEAP8BvgMAAAAAAABEAAACygMAAAAAAABEAAEC3AMAAAAAAABEAAIC7gMAAAAA
AABEAAMC/AMAAAAAAABEAAQCCgQAAAAAAABEAAUCGAQAAAAAAABEAAcCKAQAAAAAAABEAAgCLAQA
AAAAAABEAAgCLAQAAFBRAACAAJwBgP///3hRAACAAJ0B9P7//wAAAADAAAAACQAAAN5QAACAAKAB
8P7//4ZRAACAAKEB7P7//wAAAADAAAAAFgAAAAAAAADgAAAAlQAAAAAAAADgAAAALAQAAAAAAAAk
AAAALgQAAI5RAAAkAAwCqJcECAAAAABEAAwCAAAAAAAAAABEAA0CCQAAAAAAAABEABACCQAAAAAA
AABEABECEgAAAAAAAABEABcCGAAAAAAAAABEABgCKgAAAAAAAABEABkCMAAAAAAAAABEABoCPQAA
AAAAAABEABsCTwAAAAAAAABEABwCVQAAAAAAAABEAB0CYgAAAAAAAABEAB4CbAAAAAAAAABEAB8C
dgAAAAAAAABEACACjAAAAAAAAABEACQCrwAAAAAAAABEACUCtQAAAAAAAABEACoCwgAAAAAAAABE
ACsCzAAAAAAAAABEACwC3QAAAAAAAABEAC4C5wAAAAAAAABEADIC7QAAAAAAAABEADQC9wAAAAAA
AABEADUCCAEAAAAAAABEADcCDwEAAAAAAABEADgCIQEAAAAAAABEADoCIQEAAAAAAABEADwCLwEA
AAAAAABEAD0CQgEAAAAAAABEAD4CVwEAAAAAAABEAD8CZgEAAAAAAABEAEMCZgEAAAAAAABEAEMC
ZgEAAK9QAACAAA0C/P///+hQAACAAA4CbP///wAAAADAAAAACQAAAFBRAACAADgC7P7//wAAAADA
AAAAIQEAAAAAAADgAAAAZgEAAAAAAADgAAAAZgEAAAAAAAAkAAAAaAEAAK5RAAAkAEwCEJkECAAA
AABEAEwCAAAAAAAAAABEAE0CBgAAAAAAAABEAE8CBgAAAAAAAABEAFACIAAAAAAAAABEAFECNwAA
AAAAAABEAFICVAAAAAAAAABEAE8CbAAAAAAAAABEAFUCcQAAAAAAAABEAFYCfAAAAAAAAABEAFcC
hgAAAAAAAABEAFgCkAAAAAAAAABEAFkCmgAAAAAAAABEAFoCrgAAAAAAAABEAFwCwgAAAAAAAABE
AF0CxwAAAAAAAABEAF0CxwAAAIZRAACAAE0C/P///wAAAADAAAAABgAAAAAAAADgAAAAxwAAAAAA
AAAkAAAAyQAAAMdRAAAkAGYC3JkECOBRAACgAGUCCAAAAAAAAABEAGYCAAAAAAAAAABEAGcCAwAA
AAAAAABEAGgCEQAAAAAAAABEAGkCGwAAAAAAAABEAGoCJAAAAAAAAABEAGsCLgAAAAAAAABEAGwC
OAAAAAAAAABEAG0CQgAAAAAAAABEAG4CTAAAAAAAAABEAG8CVgAAAAAAAABEAHACYAAAAAAAAABE
AHECagAAAAAAAABEAHICdAAAAAAAAABEAHMCeAAAAAAAAAAkAAAAegAAAPZRAAAkAHcCWJoECBNS
AACgAHYCCAAAACFSAACgAHYCDAAAAAAAAABEAHcCAAAAAAAAAABEAHgCAwAAAAAAAABEAHoCGAAA
AAAAAABEAHsCIQAAAAAAAABEAH0CKAAAAAAAAABEAH8CLwAAAAAAAABEAIECOAAAAAAAAAAkAAAA
OgAAAC5SAAAkAIUClJoECBNSAACgAIQCCAAAAE9SAACgAIQCDAAAAAAAAABEAIUCAAAAAAAAAABE
AIYCAwAAAAAAAABEAIcCDAAAAAAAAABEAIgCFgAAAAAAAABEAIkCGgAAAAAAAAAkAAAAHgAAAGBS
AAAkAI4CtJoECBNSAACgAI0CCAAAAIFSAACgAI0CDAAAAAAAAABEAI4CAAAAAAAAAABEAJACAwAA
AAAAAABEAJECDAAAAAAAAABEAJMCEwAAAAAAAABEAJQCHAAAAAAAAABEAJUCIAAAAAAAAAAkAAAA
IgAAAJJSAAAkAKQC2JoECKhSAACgAKACCAAAAMNSAACgAKECDAAAANFSAACgAKICEAAAAI9QAACg
AKMCFAAAAAAAAABEAKQCAAAAAAAAAABEAKUCCQAAAAAAAABEAKsCDwAAAAAAAABEAKwCFAAAAAAA
AABEAK4CGQAAAAAAAABEAK8CHwAAAAAAAABEALECKQAAAAAAAABEALICMgAAAAAAAABEALQCPAAA
AAAAAABEALUCRQAAAAAAAABEALcCTwAAAAAAAABEALgCWQAAAAAAAABEALkCYgAAAAAAAABEALoC
awAAAAAAAABEALsCdAAAAAAAAABEALwCfQAAAAAAAABEAL4CkwAAAAAAAABEAL8CtQAAAAAAAABE
AMACvgAAAAAAAABEAMECywAAAAAAAABEAMIC1wAAAAAAAABEAMYC6AAAAAAAAABEAMcCBwEAAAAA
AABEAMgCHgEAAAAAAABEAMkCKwEAAAAAAABEAMoCQgEAAAAAAABEAMsCTAEAAAAAAABEAMwCVQEA
AAAAAABEAM0CWAEAAAAAAABEAM4CYQEAAAAAAABEAM8CdQEAAAAAAABEANICiAEAAAAAAABEANMC
kgEAAAAAAABEANMCkgEAAOhSAACAAKUC/P///5pQAACAAKYCaP///6VQAACAAKcCZP///69QAACA
AKgCYP///wAAAADAAAAACQAAAAAAAADgAAAAkgEAAAAAAAAkAAAAmgEAAPZSAAAkANwCdJwECApT
AACgANsCCAAAABpTAACgANsCDAAAAAAAAABEANwCAAAAAAAAAABEAN0CBgAAAAAAAABEAOACDAAA
AAAAAABEAOICEQAAAAAAAABEAOMCKgAAAAAAAABEAOQCMAAAAAAAAABEAOYCQQAAAAAAAABEAOcC
TAAAAAAAAABEAOcCTAAAANFQAACAAN0C/P///69QAACAAN4C+P///wAAAADAAAAABgAAAAAAAADg
AAAATAAAAAAAAAAkAAAATgAAACdTAAAkAPACxJwECAAAAABEAPACAAAAAAAAAABEAPECBgAAAAAA
AABEAPICEAAAAAAAAABEAPMCQQAAAAAAAABEAPUCWQAAAAAAAABEAPUCWQAAAIZRAACAAPEC/P//
/wAAAADAAAAABgAAAAAAAADgAAAAWQAAAAAAAAAkAAAAXgAAAD1TAAAkAP8CJJ0ECFRTAACgAP4C
CAAAAF9TAACgAP4CDAAAAHhTAACgAP4CEAAAAAAAAABEAP8CAAAAAAAAAABEAAADAwAAAAAAAABE
AAEDHgAAAAAAAABEAAMDLwAAAAAAAABEAAQDMwAAAAAAAAAkAAAANQAAAJFTAAAkABADXJ0ECKJT
AACgAA8DCAAAAK1TAACgAA8DDAAAAMJTAACgAA8DEAAAAAAAAABEABADAAAAAAAAAABEABEDDAAA
AAAAAABEABQDDAAAAAAAAABEABYDEgAAAAAAAABEABcDJQAAAAAAAABEABoDQQAAAAAAAABEABwD
SwAAAAAAAABEAB0DVwAAAAAAAABEAB8DWQAAAAAAAABEACADYwAAAAAAAABEACEDgQAAAAAAAABE
ACIDiAAAAAAAAABEACQDlAAAAAAAAABEACUDmgAAAAAAAABEACYDyAAAAAAAAABEACcDzgAAAAAA
AABEACkD8wAAAAAAAABEACsD9wAAAAAAAABEACsD9wAAANhTAACAABEDdP///+ZTAACAABIDcP//
/wAAAADAAAAADAAAAAAAAADgAAAA9wAAAAAAAAAkAAAAAgEAAPZTAAAkADYDYJ4ECBpTAACgADUD
CAAAAAAAAABEADYDAAAAAAAAAABEADcDCAAAAAAAAABEADoDEAAAAAAAAABEADsDGwAAAAAAAABE
ADwDKwAAAAAAAABEAD0DQgAAAAAAAABEAD4DXwAAAAAAAABEAD8DbwAAAAAAAABEAD8DbwAAANFQ
AACAADcD/P///xNUAACAADgD+P///wAAAADAAAAACAAAAAAAAADgAAAAbwAAAAAAAAAkAAAAdgAA
ACZUAAAkAEkD2J4ECBpTAACgAEgDCAAAAAAAAABEAEkDAAAAAAAAAABEAEsDAwAAAAAAAAAkAAAA
BQAAAEhUAAAkAE8D4J4ECBpTAACgAE4DCAAAAAAAAABEAE8DAAAAAAAAAABEAFEDAwAAAAAAAAAk
AAAABQAAAGxUAAAkAF0D6J4ECIVUAACgAFwDCAAAAAAAAABEAF0DAAAAAAAAAABEAF4DBgAAAAAA
AABEAGADEAAAAAAAAABEAGIDGAAAAAAAAABEAGQDLwAAAAAAAABEAGUDPQAAAAAAAABEAGcDPwAA
AAAAAABEAGkDVQAAAAAAAABEAGkDVQAAAJBUAACAAF4D/P///wAAAADAAAAABgAAAAAAAADgAAAA
VQAAAAAAAAAkAAAAVwAAAJxUAAAkAHMDQJ8ECBpTAACgAHIDCAAAAAAAAABEAHMDAAAAAAAAAABE
AHQDBgAAAAAAAABEAHUDBgAAAAAAAABEAHoDEAAAAAAAAABEAHsDGQAAAAAAAABEAHwDJwAAAAAA
AABEAH0DMAAAAAAAAABEAH8DPAAAAAAAAABEAIMDUAAAAAAAAABEAIUDgAAAAAAAAABEAIYDmAAA
AAAAAABEAIcDsQAAAAAAAABEAIgDywAAAAAAAABEAIoD3QAAAAAAAABEAIUD3QAAAAAAAABEAI4D
4gAAAAAAAABEAI8D8AAAAAAAAABEAI8D8AAAAIZRAACAAHQD/P///79UAACAAHUD+P///wAAAADA
AAAABgAAAM1UAACAAIYD9P///wAAAADAAAAAmAAAAAAAAADgAAAA3QAAAAAAAADgAAAA8AAAAAAA
AAAkAAAA8gAAANlUAAAkAJgDNKAECBpTAACgAJcDCAAAAAAAAABEAJgDAAAAAAAAAABEAJkDBgAA
AAAAAABEAKMDEAAAAAAAAABEAKoDKAAAAAAAAABEAKsDMgAAAAAAAABEALADNAAAAAAAAABEALID
TAAAAAAAAABEALMDVgAAAAAAAABEALUDXAAAAAAAAABEALcDbAAAAAAAAABEALcDbAAAAL9UAACA
AJkD/P////tUAACAAJoD+P///whVAACAAJsD9P///wAAAADAAAAABgAAAAAAAADgAAAAbAAAAAAA
AAAkAAAAbgAAABNVAAAkAMEDpKAECBpTAACgAMADCAAAAAAAAABEAMEDAAAAAAAAAABEAMIDBgAA
AAAAAABEAMYDEAAAAAAAAABEAMgDLAAAAAAAAABEAMkDNgAAAAAAAABEAMsDPAAAAAAAAABEAM0D
TAAAAAAAAABEAM0DTAAAAL9UAACAAMID/P///wAAAADAAAAABgAAAAAAAADgAAAATAAAAAAAAAAk
AAAATgAAADdVAAAkANgD9KAECBpTAACgANcDCAAAAAAAAABEANgDAAAAAAAAAABEANkDCQAAAAAA
AABEAOEDEwAAAAAAAABEAOIDJQAAAAAAAABEAOQDLQAAAAAAAABEAOYDRgAAAAAAAABEAOcDXgAA
AAAAAABEAOgDfQAAAAAAAABEAOoDkgAAAAAAAABEAOsDnAAAAAAAAABEAOwDpgAAAAAAAABEAO0D
twAAAAAAAABEAOYDtwAAAAAAAABEAO4DvwAAAAAAAABEAO8DxAAAAAAAAABEAPED4QAAAAAAAABE
APID/AAAAAAAAABEAPMDGwEAAAAAAABEAPUDMAEAAAAAAABEAPYDOgEAAAAAAABEAPcDRAEAAAAA
AABEAPgDVQEAAAAAAABEAPEDVQEAAAAAAABEAPkDXQEAAAAAAABEAPoDcwEAAAAAAABEAPsDfQEA
AAAAAABEAPwDhwEAAAAAAABEAP0DmAEAAAAAAABEAP4DnAEAAAAAAABEAAEEpQEAAAAAAABEAAIE
uwEAAAAAAABEAAMExQEAAAAAAABEAAQEzwEAAAAAAABEAAcE4AEAAAAAAABEAAgE6gEAAAAAAABE
AAkE/AEAAAAAAABEAAoEAwIAAAAAAABEAA0EGAIAAAAAAABEAA4EJAIAAAAAAABEAA4EJAIAAL9U
AACAANkD/P///3hRAACAANoDcP///1lVAACAANsDaP///4ZRAACAANwDZP///wAAAADAAAAACQAA
AM1UAACAAOcDYP///wAAAADAAAAAXgAAAAAAAADgAAAAtwAAAM1UAACAAPIDYP///wAAAADAAAAA
/AAAAAAAAADgAAAAVQEAAAAAAADgAAAAJAIAAAAAAAAkAAAAJgIAAGtVAAAkABkEHKMECAAAAABE
ABkEAAAAAAAAAABEABoEBgAAAAAAAABEABwEBgAAAAAAAABEAB4EDgAAAAAAAABEAB8EGgAAAAAA
AABEAB8EGgAAANFQAACAABoE/P///wAAAADAAAAABgAAAAAAAADgAAAAGgAAAAAAAAAkAAAAHAAA
AIRVAAAkACMEOKMECAAAAABEACMEAAAAAAAAAABEACQEBgAAAAAAAABEACYEBgAAAAAAAABEACgE
DgAAAAAAAABEACkEGgAAAAAAAABEACkEGgAAANFQAACAACQE/P///wAAAADAAAAABgAAAAAAAADg
AAAAGgAAAAAAAAAkAAAAHAAAAJ9VAAAkADUEVKMECLxVAACgADQECAAAAMhVAACgADQEDAAAAAAA
AABEADUEAAAAAAAAAABEADYEBgAAAAAAAABEADkEDgAAAAAAAABEADoEFAAAAAAAAABEADsEIQAA
AAAAAABEADwEOwAAAAAAAABEAD0EPwAAAAAAAABEAD0EPwAAANFQAACAADYE/P///wAAAADAAAAA
BgAAAAAAAADgAAAAPwAAAAAAAAAkAAAAQQAAAOFVAAAgAD8EAAAAABJWAAAkAEMEmKMECLxVAACg
AEIECAAAAAAAAABEAEMEAAAAAAAAAABEAEQEBgAAAAAAAABEAEYEDgAAAAAAAABEAEcEFAAAAAAA
AABEAEoEIQAAAAAAAABEAEsEPAAAAAAAAABEAEsEPAAAANFQAACAAEQE/P///wAAAADAAAAABgAA
AAAAAADgAAAAPAAAAAAAAAAkAAAAPgAAAC9WAAAgAE0EAAAAAGBWAAAkAFQE2KMECH5WAACgAFME
CAAAAAAAAABEAFQEAAAAAAAAAABEAFUEAwAAAAAAAABEAFYEBwAAAAAAAAAkAAAACgAAAJVWAAAk
AFoE5KMECLZWAACgAFkECAAAAAAAAABEAFoEAAAAAAAAAABEAFsEAwAAAAAAAABEAFwEBwAAAAAA
AAAkAAAADgAAAMRWAAAkAGAE9KMECLZWAACgAF8ECAAAAAAAAABEAGAEAAAAAAAAAABEAGEEAwAA
AAAAAABEAGIEBwAAAAAAAAAkAAAADgAAAOVWAAAkAGYEBKQECP9WAACgAGUECAAAABNXAACgAGUE
DAAAAAAAAABEAGYEAAAAAAAAAABEAGcEAwAAAAAAAABEAGgEDQAAAAAAAABEAGkEEQAAAAAAAAAk
AAAAEwAAACpXAAAkAG0EGKQECERXAACgAGwECAAAAAAAAABEAG0EAAAAAAAAAABEAG4EBgAAAAAA
AABEAG8EDQAAAAAAAABEAHAEKAAAAAAAAABEAHEELgAAAAAAAABEAHIEMwAAAAAAAABEAHMENgAA
AAAAAABEAHUEOAAAAAAAAABEAHYEOAAAAAAAAABEAHcEPwAAAAAAAABEAHgERgAAAAAAAABEAHkE
VAAAAAAAAABEAHoEWwAAAAAAAABEAHsEWwAAAAAAAABEAHwEXQAAAAAAAABEAH0EYQAAAAAAAABE
AH0EYQAAAE9XAACAAG4E/P///wAAAADAAAAABgAAAFlXAACAAHUE9P///wAAAADAAAAAOAAAAAAA
AADgAAAAWwAAAAAAAADgAAAAYQAAAAAAAAAkAAAAagAAAGNXAAAkAIEEhKQECERXAACgAIAECAAA
AAAAAABEAIEEAAAAAAAAAABEAIIEAwAAAAAAAABEAIMEDQAAAAAAAABEAIQEEQAAAAAAAAAkAAAA
EwAAAH9XAAAkAIgEmKQECERXAACgAIcECAAAAAAAAABEAIgEAAAAAAAAAABEAIkEAwAAAAAAAABE
AIoEGAAAAAAAAABEAIwEKAAAAAAAAABEAI0ELAAAAAAAAAAkAAAALgAAAJxXAAAkAJEEyKQECERX
AACgAJAECAAAAAAAAABEAJEEAAAAAAAAAABEAJIEAwAAAAAAAABEAJMEBwAAAAAAAAAkAAAACgAA
ALlXAAAkAJcE1KQECNVXAACgAJYECAAAAAAAAABEAJcEAAAAAAAAAABEAJgEBgAAAAAAAABEAJoE
BgAAAAAAAABEAKAEFgAAAAAAAABEAKEEHQAAAAAAAABEAKEEHQAAAOZXAACAAJgE/P///wAAAADA
AAAABgAAAAAAAADgAAAAHQAAAAAAAAAkAAAAHwAAAPBXAAAmAKcEwLsECAVYAAAmAKgExLsECBpY
AAAkAKwE9KQECAAAAABEAKwEAAAAAAAAAABEAK0EAwAAAAAAAABEAK4EDQAAAAAAAAAkAAAADwAA
ADlYAAAkALIEBKUECAAAAABEALIEAAAAAAAAAABEALMEAwAAAAAAAABEALQEDQAAAAAAAAAkAAAA
DwAAAFhYAAAkALgEFKUECHVYAACgALcECAAAAAAAAABEALgEAAAAAAAAAABEALkEAwAAAAAAAABE
ALoEHAAAAAAAAABEALsEIwAAAAAAAABEALwESwAAAAAAAAAkAAAATgAAAAAAAACiAAAAAAAAAIFY
AAAkACMAZKUECFcTAACEAAAAZKUECAAAAABEACMAAAAAAAAAAABEACQAAwAAAAAAAABEACUADwAA
AAAAAAAkAAAAEQAAAJFYAAAkACkAeKUECIVUAACgACgACAAAAAAAAABEACkAAAAAAAAAAABEACoA
AwAAAAAAAABEACsADwAAAAAAAAAkAAAAEQAAAKlYAAAkAC8AjKUECLVYAACgAC4ACAAAAMFYAACg
AC4ADAAAAAAAAABEAC8AAAAAAAAAAABEADAACQAAAAAAAABEADYACQAAAAAAAABEADgAEwAAAAAA
AABEADkAGQAAAAAAAABEADwAMgAAAAAAAABEAEgANwAAAAAAAABEAEkAVAAAAAAAAABEAEoAYAAA
AAAAAABEAEsAcgAAAAAAAABEAEwAkgAAAAAAAABEAE4ApwAAAAAAAABEAE8AxQAAAAAAAABEAFAA
ywAAAAAAAABEAEgA2AAAAAAAAABEAFMA5AAAAAAAAABEAFUA8AAAAAAAAABEAFYA9AAAAAAAAABE
AFYA9AAAAK9QAACAADAA/P///9ZYAACAADEA8P////lYAACAADIAzP///wVZAACAADMAyP///4ZR
AACAADQAxP///3hRAACAADUAOP///xJZAACAADYANP///wAAAADAAAAACQAAAAAAAADgAAAA9AAA
AAAAAAAkAAAA9gAAACJZAAAkAFwAhKYECI9QAACgAFsACAAAAAAAAABEAFwAAAAAAAAAAABEAF0A
BgAAAAAAAABEAGQADAAAAAAAAABEAGUAIwAAAAAAAABEAGYAMQAAAAAAAABEAGcARQAAAAAAAABE
AGgATAAAAAAAAABEAGkAYQAAAAAAAABEAGsAbgAAAAAAAABEAGwAhgAAAAAAAABEAG0AnQAAAAAA
AABEAG4AuAAAAAAAAABEAG8A1QAAAAAAAABEAHgA4AAAAAAAAABEAIAA9AAAAAAAAABEAIMA/AAA
AAAAAABEAIMA/AAAAC9ZAACAAF0A/P///zdZAACAAF4A+P///69QAACAAF8A9P///0dZAACAAGAA
1P///2ZZAACAAGEA0P///3BZAACAAGIAxP///wAAAADAAAAABgAAAAAAAADgAAAA/AAAAAAAAAAk
AAAA/gAAAHpZAAAkAIkAhKcECItZAACgAIgACAAAAAAAAABEAIkAAAAAAAAAAABEAIoABgAAAAAA
AABEAIwABgAAAAAAAABEAI0ADAAAAAAAAABEAI4AHwAAAAAAAABEAI8ANQAAAAAAAABEAJEASAAA
AAAAAABEAJIATQAAAAAAAABEAJIATQAAAJdZAACAAIoA/P///wAAAADAAAAABgAAAAAAAADgAAAA
TQAAAAAAAAAkAAAATwAAAKFZAAAoAJEAYL0ECNNZAAAoALMAYL4ECAtaAAAgAMkAAAAAACpaAAAo
AB8AYL4UCEtaAAAgAFgAAAAAAAAAAABkAAAA06cECABpbml0LmMAL3Vzci9zcmMvYnMvQlVJTEQv
Z2xpYmMtMi4xLjMvY3N1LwBnY2MyX2NvbXBpbGVkLgBpbnQ6dCgwLDEpPXIoMCwxKTswMDIwMDAw
MDAwMDAwOzAwMTc3Nzc3Nzc3Nzc7AGNoYXI6dCgwLDIpPXIoMCwyKTswOzEyNzsAbG9uZyBpbnQ6
dCgwLDMpPXIoMCwxKTswMDIwMDAwMDAwMDAwOzAwMTc3Nzc3Nzc3Nzc7AHVuc2lnbmVkIGludDp0
KDAsNCk9cigwLDEpOzAwMDAwMDAwMDAwMDA7MDAzNzc3Nzc3Nzc3NzsAbG9uZyB1bnNpZ25lZCBp
bnQ6dCgwLDUpPXIoMCwxKTswMDAwMDAwMDAwMDAwOzAwMzc3Nzc3Nzc3Nzc7AGxvbmcgbG9uZyBp
bnQ6dCgwLDYpPXIoMCwxKTswMTAwMDAwMDAwMDAwMDAwMDAwMDAwMDswNzc3Nzc3Nzc3Nzc3Nzc3
Nzc3Nzc3OwBsb25nIGxvbmcgdW5zaWduZWQgaW50OnQoMCw3KT1yKDAsMSk7MDAwMDAwMDAwMDAw
MDswMTc3Nzc3Nzc3Nzc3Nzc3Nzc3Nzc3NzsAc2hvcnQgaW50OnQoMCw4KT1yKDAsOCk7LTMyNzY4
OzMyNzY3OwBzaG9ydCB1bnNpZ25lZCBpbnQ6dCgwLDkpPXIoMCw5KTswOzY1NTM1OwBzaWduZWQg
Y2hhcjp0KDAsMTApPXIoMCwxMCk7LTEyODsxMjc7AHVuc2lnbmVkIGNoYXI6dCgwLDExKT1yKDAs
MTEpOzA7MjU1OwBmbG9hdDp0KDAsMTIpPXIoMCwxKTs0OzA7AGRvdWJsZTp0KDAsMTMpPXIoMCwx
KTs4OzA7AGxvbmcgZG91YmxlOnQoMCwxNCk9cigwLDEpOzEyOzA7AGNvbXBsZXggaW50OnQoMCwx
NSk9czhyZWFsOigwLDEpLDAsMzI7aW1hZzooMCwxKSwzMiwzMjs7AGNvbXBsZXggZmxvYXQ6dCgw
LDE2KT1yKDAsMTYpOzQ7MDsAY29tcGxleCBkb3VibGU6dCgwLDE3KT1yKDAsMTcpOzg7MDsAY29t
cGxleCBsb25nIGRvdWJsZTp0KDAsMTgpPXIoMCwxOCk7MTI7MDsAdm9pZDp0KDAsMTkpPSgwLDE5
KQAuLi9pbmNsdWRlL2xpYmMtc3ltYm9scy5oAC91c3Ivc3JjL2JzL0JVSUxEL2dsaWJjLTIuMS4z
L2J1aWxkLWkzODYtbGludXgvY29uZmlnLmgALi4vaW5jbHVkZS9saWJpbnRsLmgALi4vaW50bC9s
aWJpbnRsLmgALi4vaW5jbHVkZS9mZWF0dXJlcy5oAC4uL2luY2x1ZGUvc3lzL2NkZWZzLmgALi4v
bWlzYy9zeXMvY2RlZnMuaAAvdXNyL2xpYi9nY2MtbGliL2kzODYtcmVkaGF0LWxpbnV4L2VnY3Mt
Mi45MS42Ni9pbmNsdWRlL3N0ZGRlZi5oAC4uL2luY2x1ZGUvbG9jYWxlLmgALi4vbG9jYWxlL2xv
Y2FsZS5oAGxjb252OlQoMTAsMSk9czQ4ZGVjaW1hbF9wb2ludDooMTAsMik9KigwLDIpLDAsMzI7
dGhvdXNhbmRzX3NlcDooMTAsMiksMzIsMzI7XABncm91cGluZzooMTAsMiksNjQsMzI7aW50X2N1
cnJfc3ltYm9sOigxMCwyKSw5NiwzMjtcAGN1cnJlbmN5X3N5bWJvbDooMTAsMiksMTI4LDMyO21v
bl9kZWNpbWFsX3BvaW50OigxMCwyKSwxNjAsMzI7XABtb25fdGhvdXNhbmRzX3NlcDooMTAsMiks
MTkyLDMyO21vbl9ncm91cGluZzooMTAsMiksMjI0LDMyO1wAcG9zaXRpdmVfc2lnbjooMTAsMiks
MjU2LDMyO25lZ2F0aXZlX3NpZ246KDEwLDIpLDI4OCwzMjtcAGludF9mcmFjX2RpZ2l0czooMCwy
KSwzMjAsODtmcmFjX2RpZ2l0czooMCwyKSwzMjgsODtcAHBfY3NfcHJlY2VkZXM6KDAsMiksMzM2
LDg7cF9zZXBfYnlfc3BhY2U6KDAsMiksMzQ0LDg7XABuX2NzX3ByZWNlZGVzOigwLDIpLDM1Miw4
O25fc2VwX2J5X3NwYWNlOigwLDIpLDM2MCw4O1wAcF9zaWduX3Bvc246KDAsMiksMzY4LDg7bl9z
aWduX3Bvc246KDAsMiksMzc2LDg7OwAuLi9pbmNsdWRlL3hsb2NhbGUuaAAuLi9sb2NhbGUveGxv
Y2FsZS5oAF9fbG9jYWxlX3N0cnVjdDpUKDEzLDEpPXMzNl9fbG9jYWxlczooMTMsMik9YXIoMCwx
KTswOzU7KDEzLDMpPSooMTMsNCk9eHNsb2NhbGVfZGF0YTosMCwxOTI7XABfX2N0eXBlX2I6KDEz
LDUpPSooMCw5KSwxOTIsMzI7X19jdHlwZV90b2xvd2VyOigxMyw2KT0qKDAsMSksMjI0LDMyO1wA
X19jdHlwZV90b3VwcGVyOigxMyw2KSwyNTYsMzI7OwBfX2xvY2FsZV90OnQoMTMsNyk9KDEzLDgp
PSooMTMsMSkALi4vc3lzZGVwcy91bml4L3N5c3YvbGludXgvX0dfY29uZmlnLmgALi4vc3lzZGVw
cy91bml4L3N5c3YvbGludXgvYml0cy90eXBlcy5oAHNpemVfdDp0KDE2LDEpPSgwLDQpAF9fdV9j
aGFyOnQoMTUsMSk9KDAsMTEpAF9fdV9zaG9ydDp0KDE1LDIpPSgwLDkpAF9fdV9pbnQ6dCgxNSwz
KT0oMCw0KQBfX3VfbG9uZzp0KDE1LDQpPSgwLDUpAF9fdV9xdWFkX3Q6dCgxNSw1KT0oMCw3KQBf
X3F1YWRfdDp0KDE1LDYpPSgwLDYpAF9faW50OF90OnQoMTUsNyk9KDAsMTApAF9fdWludDhfdDp0
KDE1LDgpPSgwLDExKQBfX2ludDE2X3Q6dCgxNSw5KT0oMCw4KQBfX3VpbnQxNl90OnQoMTUsMTAp
PSgwLDkpAF9faW50MzJfdDp0KDE1LDExKT0oMCwxKQBfX3VpbnQzMl90OnQoMTUsMTIpPSgwLDQp
AF9faW50NjRfdDp0KDE1LDEzKT0oMCw2KQBfX3VpbnQ2NF90OnQoMTUsMTQpPSgwLDcpAF9fcWFk
ZHJfdDp0KDE1LDE1KT0oMTUsMTYpPSooMTUsNikAX19kZXZfdDp0KDE1LDE3KT0oMTUsNSkAX191
aWRfdDp0KDE1LDE4KT0oMTUsMykAX19naWRfdDp0KDE1LDE5KT0oMTUsMykAX19pbm9fdDp0KDE1
LDIwKT0oMTUsNCkAX19tb2RlX3Q6dCgxNSwyMSk9KDE1LDMpAF9fbmxpbmtfdDp0KDE1LDIyKT0o
MTUsMykAX19vZmZfdDp0KDE1LDIzKT0oMCwzKQBfX2xvZmZfdDp0KDE1LDI0KT0oMTUsNikAX19w
aWRfdDp0KDE1LDI1KT0oMCwxKQBfX3NzaXplX3Q6dCgxNSwyNik9KDAsMSkAX19ybGltX3Q6dCgx
NSwyNyk9KDAsMykAX19ybGltNjRfdDp0KDE1LDI4KT0oMTUsNikAX19pZF90OnQoMTUsMjkpPSgx
NSwzKQBfX2ZzaWRfdDp0KDE1LDMwKT0oMTUsMzEpPXM4X192YWw6KDE1LDMyKT1hcigwLDEpOzA7
MTsoMCwxKSwwLDY0OzsAX19kYWRkcl90OnQoMTUsMzMpPSgwLDEpAF9fY2FkZHJfdDp0KDE1LDM0
KT0oMTAsMikAX190aW1lX3Q6dCgxNSwzNSk9KDAsMykAX19zd2Jsa190OnQoMTUsMzYpPSgwLDMp
AF9fY2xvY2tfdDp0KDE1LDM3KT0oMCwzKQBfX2ZkX21hc2s6dCgxNSwzOCk9KDAsNSkAX19mZF9z
ZXQ6dCgxNSwzOSk9KDE1LDQwKT1zMTI4ZmRzX2JpdHM6KDE1LDQxKT1hcigwLDEpOzA7MzE7KDE1
LDM4KSwwLDEwMjQ7OwBfX2tleV90OnQoMTUsNDIpPSgwLDEpAF9faXBjX3BpZF90OnQoMTUsNDMp
PSgwLDkpAF9fYmxrY250X3Q6dCgxNSw0NCk9KDAsMykAX19ibGtjbnQ2NF90OnQoMTUsNDUpPSgx
NSw2KQBfX2ZzYmxrY250X3Q6dCgxNSw0Nik9KDE1LDQpAF9fZnNibGtjbnQ2NF90OnQoMTUsNDcp
PSgxNSw1KQBfX2ZzZmlsY250X3Q6dCgxNSw0OCk9KDE1LDQpAF9fZnNmaWxjbnQ2NF90OnQoMTUs
NDkpPSgxNSw1KQBfX2lubzY0X3Q6dCgxNSw1MCk9KDE1LDQpAF9fb2ZmNjRfdDp0KDE1LDUxKT0o
MTUsMjQpAF9fdF9zY2FsYXJfdDp0KDE1LDUyKT0oMCwzKQBfX3RfdXNjYWxhcl90OnQoMTUsNTMp
PSgwLDUpAF9faW50cHRyX3Q6dCgxNSw1NCk9KDAsMSkALi4vbGludXh0aHJlYWRzL3N5c2RlcHMv
cHRocmVhZC9iaXRzL3B0aHJlYWR0eXBlcy5oAC4uL3N5c2RlcHMvdW5peC9zeXN2L2xpbnV4L2Jp
dHMvc2NoZWQuaABfX3NjaGVkX3BhcmFtOlQoMTgsMSk9czRzY2hlZF9wcmlvcml0eTooMCwxKSww
LDMyOzsAX3B0aHJlYWRfZmFzdGxvY2s6VCgxNywxKT1zOF9fc3RhdHVzOigwLDMpLDAsMzI7X19z
cGlubG9jazooMCwxKSwzMiwzMjs7AF9wdGhyZWFkX2Rlc2NyOnQoMTcsMik9KDE3LDMpPSooMTcs
NCk9eHNfcHRocmVhZF9kZXNjcl9zdHJ1Y3Q6AHB0aHJlYWRfYXR0cl90OnQoMTcsNSk9KDE3LDYp
PXMzNl9fZGV0YWNoc3RhdGU6KDAsMSksMCwzMjtcAF9fc2NoZWRwb2xpY3k6KDAsMSksMzIsMzI7
X19zY2hlZHBhcmFtOigxOCwxKSw2NCwzMjtcAF9faW5oZXJpdHNjaGVkOigwLDEpLDk2LDMyO19f
c2NvcGU6KDAsMSksMTI4LDMyO1wAX19ndWFyZHNpemU6KDE2LDEpLDE2MCwzMjtfX3N0YWNrYWRk
cl9zZXQ6KDAsMSksMTkyLDMyO1wAX19zdGFja2FkZHI6KDE3LDcpPSooMCwxOSksMjI0LDMyO19f
c3RhY2tzaXplOigxNiwxKSwyNTYsMzI7OwBwdGhyZWFkX2NvbmRfdDp0KDE3LDgpPSgxNyw5KT1z
MTJfX2NfbG9jazooMTcsMSksMCw2NDtcAF9fY193YWl0aW5nOigxNywyKSw2NCwzMjs7AHB0aHJl
YWRfY29uZGF0dHJfdDp0KDE3LDEwKT0oMTcsMTEpPXM0X19kdW1teTooMCwxKSwwLDMyOzsAcHRo
cmVhZF9rZXlfdDp0KDE3LDEyKT0oMCw0KQBwdGhyZWFkX211dGV4X3Q6dCgxNywxMyk9KDE3LDE0
KT1zMjRfX21fcmVzZXJ2ZWQ6KDAsMSksMCwzMjtcAF9fbV9jb3VudDooMCwxKSwzMiwzMjtfX21f
b3duZXI6KDE3LDIpLDY0LDMyO1wAX19tX2tpbmQ6KDAsMSksOTYsMzI7X19tX2xvY2s6KDE3LDEp
LDEyOCw2NDs7AHB0aHJlYWRfbXV0ZXhhdHRyX3Q6dCgxNywxNSk9KDE3LDE2KT1zNF9fbXV0ZXhr
aW5kOigwLDEpLDAsMzI7OwBwdGhyZWFkX29uY2VfdDp0KDE3LDE3KT0oMCwxKQBfcHRocmVhZF9y
d2xvY2tfdDpUKDE3LDE4KT1zMzJfX3J3X2xvY2s6KDE3LDEpLDAsNjQ7X19yd19yZWFkZXJzOigw
LDEpLDY0LDMyO1wAX19yd193cml0ZXI6KDE3LDIpLDk2LDMyO19fcndfcmVhZF93YWl0aW5nOigx
NywyKSwxMjgsMzI7XABfX3J3X3dyaXRlX3dhaXRpbmc6KDE3LDIpLDE2MCwzMjtfX3J3X2tpbmQ6
KDAsMSksMTkyLDMyO1wAX19yd19wc2hhcmVkOigwLDEpLDIyNCwzMjs7AHB0aHJlYWRfcndsb2Nr
X3Q6dCgxNywxOSk9KDE3LDE4KQBwdGhyZWFkX3J3bG9ja2F0dHJfdDp0KDE3LDIwKT0oMTcsMjEp
PXM4X19sb2Nra2luZDooMCwxKSwwLDMyO1wAX19wc2hhcmVkOigwLDEpLDMyLDMyOzsAcHRocmVh
ZF90OnQoMTcsMjIpPSgwLDUpAHdjaGFyX3Q6dCgxOSwxKT0oMCwzKQB3aW50X3Q6dCgxOSwyKT0o
MCw0KQBfR19pbnQxNl90OnQoMTQsMSk9KDAsOCkAX0dfaW50MzJfdDp0KDE0LDIpPSgwLDEpAF9H
X3VpbnQxNl90OnQoMTQsMyk9KDAsOSkAX0dfdWludDMyX3Q6dCgxNCw0KT0oMCw0KQBfSU9fc3Rk
aW5fdXNlZDpHKDAsMSkAL3Uvd3R3LwB0ZXN0LXB0aHJlYWQuYwAvdXNyL2luY2x1ZGUvc3RkaW8u
aAAvdXNyL2luY2x1ZGUvZmVhdHVyZXMuaAAvdXNyL2luY2x1ZGUvc3lzL2NkZWZzLmgAL3Vzci9p
bmNsdWRlL2dudS9zdHVicy5oAC91c3IvbGliL2djYy1saWIvaTM4Ni1yZWRoYXQtbGludXgvZWdj
cy0yLjkxLjY2L2luY2x1ZGUvc3RkYXJnLmgAX19nbnVjX3ZhX2xpc3Q6dCg2LDEpPSg2LDIpPSoo
MCwxOSkAL3Vzci9pbmNsdWRlL2JpdHMvdHlwZXMuaABfX3VfY2hhcjp0KDcsMSk9KDAsMTEpAF9f
dV9zaG9ydDp0KDcsMik9KDAsOSkAX191X2ludDp0KDcsMyk9KDAsNCkAX191X2xvbmc6dCg3LDQp
PSgwLDUpAF9fdV9xdWFkX3Q6dCg3LDUpPSgwLDcpAF9fcXVhZF90OnQoNyw2KT0oMCw2KQBfX2lu
dDhfdDp0KDcsNyk9KDAsMTApAF9fdWludDhfdDp0KDcsOCk9KDAsMTEpAF9faW50MTZfdDp0KDcs
OSk9KDAsOCkAX191aW50MTZfdDp0KDcsMTApPSgwLDkpAF9faW50MzJfdDp0KDcsMTEpPSgwLDEp
AF9fdWludDMyX3Q6dCg3LDEyKT0oMCw0KQBfX2ludDY0X3Q6dCg3LDEzKT0oMCw2KQBfX3VpbnQ2
NF90OnQoNywxNCk9KDAsNykAX19xYWRkcl90OnQoNywxNSk9KDcsMTYpPSooNyw2KQBfX2Rldl90
OnQoNywxNyk9KDcsNSkAX191aWRfdDp0KDcsMTgpPSg3LDMpAF9fZ2lkX3Q6dCg3LDE5KT0oNywz
KQBfX2lub190OnQoNywyMCk9KDcsNCkAX19tb2RlX3Q6dCg3LDIxKT0oNywzKQBfX25saW5rX3Q6
dCg3LDIyKT0oNywzKQBfX29mZl90OnQoNywyMyk9KDAsMykAX19sb2ZmX3Q6dCg3LDI0KT0oNyw2
KQBfX3BpZF90OnQoNywyNSk9KDAsMSkAX19zc2l6ZV90OnQoNywyNik9KDAsMSkAX19ybGltX3Q6
dCg3LDI3KT0oMCwzKQBfX3JsaW02NF90OnQoNywyOCk9KDcsNikAX19pZF90OnQoNywyOSk9KDcs
MykAX19mc2lkX3Q6dCg3LDMwKT0oNywzMSk9czhfX3ZhbDooNywzMik9YXIoMCwxKTswOzE7KDAs
MSksMCw2NDs7AF9fZGFkZHJfdDp0KDcsMzMpPSgwLDEpAF9fY2FkZHJfdDp0KDcsMzQpPSg3LDM1
KT0qKDAsMikAX190aW1lX3Q6dCg3LDM2KT0oMCwzKQBfX3N3YmxrX3Q6dCg3LDM3KT0oMCwzKQBf
X2Nsb2NrX3Q6dCg3LDM4KT0oMCwzKQBfX2ZkX21hc2s6dCg3LDM5KT0oMCw1KQBfX2ZkX3NldDp0
KDcsNDApPSg3LDQxKT1zMTI4X19mZHNfYml0czooNyw0Mik9YXIoMCwxKTswOzMxOyg3LDM5KSww
LDEwMjQ7OwBfX2tleV90OnQoNyw0Myk9KDAsMSkAX19pcGNfcGlkX3Q6dCg3LDQ0KT0oMCw5KQBf
X2Jsa2NudF90OnQoNyw0NSk9KDAsMykAX19ibGtjbnQ2NF90OnQoNyw0Nik9KDcsNikAX19mc2Js
a2NudF90OnQoNyw0Nyk9KDcsNCkAX19mc2Jsa2NudDY0X3Q6dCg3LDQ4KT0oNyw1KQBfX2ZzZmls
Y250X3Q6dCg3LDQ5KT0oNyw0KQBfX2ZzZmlsY250NjRfdDp0KDcsNTApPSg3LDUpAF9faW5vNjRf
dDp0KDcsNTEpPSg3LDQpAF9fb2ZmNjRfdDp0KDcsNTIpPSg3LDI0KQBfX3Rfc2NhbGFyX3Q6dCg3
LDUzKT0oMCwzKQBfX3RfdXNjYWxhcl90OnQoNyw1NCk9KDAsNSkAX19pbnRwdHJfdDp0KDcsNTUp
PSgwLDEpAEZJTEU6dCgxLDEpPSgxLDIpPXhzX0lPX0ZJTEU6AC91c3IvaW5jbHVkZS9saWJpby5o
AC91c3IvaW5jbHVkZS9fR19jb25maWcuaABfR19pbnQxNl90OnQoMTAsMSk9KDAsOCkAX0dfaW50
MzJfdDp0KDEwLDIpPSgwLDEpAF9HX3VpbnQxNl90OnQoMTAsMyk9KDAsOSkAX0dfdWludDMyX3Q6
dCgxMCw0KT0oMCw0KQBfSU9fbG9ja190OnQoOSwxKT0oMCwxOSkAX0lPX21hcmtlcjpUKDksMik9
czEyX25leHQ6KDksMyk9Kig5LDIpLDAsMzI7X3NidWY6KDksNCk9KigxLDIpLDMyLDMyO1wAX3Bv
czooMCwxKSw2NCwzMjs7AF9JT19GSUxFOlQoMSwyKT1zMTQ4X2ZsYWdzOigwLDEpLDAsMzI7X0lP
X3JlYWRfcHRyOig3LDM1KSwzMiwzMjtcAF9JT19yZWFkX2VuZDooNywzNSksNjQsMzI7X0lPX3Jl
YWRfYmFzZTooNywzNSksOTYsMzI7XABfSU9fd3JpdGVfYmFzZTooNywzNSksMTI4LDMyO19JT193
cml0ZV9wdHI6KDcsMzUpLDE2MCwzMjtcAF9JT193cml0ZV9lbmQ6KDcsMzUpLDE5MiwzMjtfSU9f
YnVmX2Jhc2U6KDcsMzUpLDIyNCwzMjtcAF9JT19idWZfZW5kOig3LDM1KSwyNTYsMzI7X0lPX3Nh
dmVfYmFzZTooNywzNSksMjg4LDMyO1wAX0lPX2JhY2t1cF9iYXNlOig3LDM1KSwzMjAsMzI7X0lP
X3NhdmVfZW5kOig3LDM1KSwzNTIsMzI7XABfbWFya2VyczooOSwzKSwzODQsMzI7X2NoYWluOig5
LDQpLDQxNiwzMjtfZmlsZW5vOigwLDEpLDQ0OCwzMjtcAF9ibGtzaXplOigwLDEpLDQ4MCwzMjtf
b2xkX29mZnNldDooNywyMyksNTEyLDMyO1wAX2N1cl9jb2x1bW46KDAsOSksNTQ0LDE2O192dGFi
bGVfb2Zmc2V0OigwLDEwKSw1NjAsODtcAF9zaG9ydGJ1ZjooOSw1KT1hcigwLDEpOzA7MDsoMCwy
KSw1NjgsODtfbG9jazooOSw2KT0qKDksMSksNTc2LDMyO1wAX29mZnNldDooNyw1MiksNjA4LDY0
O191bnVzZWQyOig5LDcpPWFyKDAsMSk7MDsxNTsoMCwxKSw2NzIsNTEyOzsAX0lPX0ZJTEU6dCg5
LDgpPSgxLDIpAF9faW9fcmVhZF9mbjp0KDksOSk9KDksMTApPWYoNywyNikAX19pb193cml0ZV9m
bjp0KDksMTEpPSg5LDEyKT1mKDcsMjYpAF9faW9fc2Vla19mbjp0KDksMTMpPSg5LDE0KT1mKDAs
MSkAX19pb19jbG9zZV9mbjp0KDksMTUpPSg5LDE2KT1mKDAsMSkAZnBvc190OnQoMSwzKT0oNywy
MykAL3Vzci9pbmNsdWRlL2JpdHMvc3RkaW9fbGltLmgAb2ZmX3Q6dCgxLDQpPSg3LDIzKQB2YV9s
aXN0OnQoMTQsMSk9KDYsMSkAL3Vzci9pbmNsdWRlL3N0cmluZy5oAC91c3IvaW5jbHVkZS91bmlz
dGQuaAAvdXNyL2luY2x1ZGUvYml0cy9wb3NpeF9vcHQuaABzc2l6ZV90OnQoMTcsMSk9KDcsMjYp
AC91c3IvaW5jbHVkZS9iaXRzL2NvbmZuYW1lLmgAIDpUKDIwLDEpPWVfUENfTElOS19NQVg6MCxf
UENfTUFYX0NBTk9OOjEsX1BDX01BWF9JTlBVVDoyLFwAX1BDX05BTUVfTUFYOjMsX1BDX1BBVEhf
TUFYOjQsX1BDX1BJUEVfQlVGOjUsXABfUENfQ0hPV05fUkVTVFJJQ1RFRDo2LF9QQ19OT19UUlVO
Qzo3LF9QQ19WRElTQUJMRTo4LFwAX1BDX1NZTkNfSU86OSxfUENfQVNZTkNfSU86MTAsX1BDX1BS
SU9fSU86MTEsXABfUENfU09DS19NQVhCVUY6MTIsX1BDX0ZJTEVTSVpFQklUUzoxMyw7ACA6VCgy
MCwyKT1lX1NDX0FSR19NQVg6MCxfU0NfQ0hJTERfTUFYOjEsX1NDX0NMS19UQ0s6MixcAF9TQ19O
R1JPVVBTX01BWDozLF9TQ19PUEVOX01BWDo0LF9TQ19TVFJFQU1fTUFYOjUsXABfU0NfVFpOQU1F
X01BWDo2LF9TQ19KT0JfQ09OVFJPTDo3LF9TQ19TQVZFRF9JRFM6OCxcAF9TQ19SRUFMVElNRV9T
SUdOQUxTOjksX1NDX1BSSU9SSVRZX1NDSEVEVUxJTkc6MTAsXABfU0NfVElNRVJTOjExLF9TQ19B
U1lOQ0hST05PVVNfSU86MTIsX1NDX1BSSU9SSVRJWkVEX0lPOjEzLFwAX1NDX1NZTkNIUk9OSVpF
RF9JTzoxNCxfU0NfRlNZTkM6MTUsX1NDX01BUFBFRF9GSUxFUzoxNixcAF9TQ19NRU1MT0NLOjE3
LF9TQ19NRU1MT0NLX1JBTkdFOjE4LF9TQ19NRU1PUllfUFJPVEVDVElPTjoxOSxcAF9TQ19NRVNT
QUdFX1BBU1NJTkc6MjAsX1NDX1NFTUFQSE9SRVM6MjEsX1NDX1NIQVJFRF9NRU1PUllfT0JKRUNU
UzoyMixcAF9TQ19BSU9fTElTVElPX01BWDoyMyxfU0NfQUlPX01BWDoyNCxfU0NfQUlPX1BSSU9f
REVMVEFfTUFYOjI1LFwAX1NDX0RFTEFZVElNRVJfTUFYOjI2LF9TQ19NUV9PUEVOX01BWDoyNyxf
U0NfTVFfUFJJT19NQVg6MjgsXABfU0NfVkVSU0lPTjoyOSxfU0NfUEFHRVNJWkU6MzAsX1NDX1JU
U0lHX01BWDozMSxcAF9TQ19TRU1fTlNFTVNfTUFYOjMyLF9TQ19TRU1fVkFMVUVfTUFYOjMzLF9T
Q19TSUdRVUVVRV9NQVg6MzQsXABfU0NfVElNRVJfTUFYOjM1LF9TQ19CQ19CQVNFX01BWDozNixf
U0NfQkNfRElNX01BWDozNyxcAF9TQ19CQ19TQ0FMRV9NQVg6MzgsX1NDX0JDX1NUUklOR19NQVg6
MzksX1NDX0NPTExfV0VJR0hUU19NQVg6NDAsXABfU0NfRVFVSVZfQ0xBU1NfTUFYOjQxLF9TQ19F
WFBSX05FU1RfTUFYOjQyLF9TQ19MSU5FX01BWDo0MyxcAF9TQ19SRV9EVVBfTUFYOjQ0LF9TQ19D
SEFSQ0xBU1NfTkFNRV9NQVg6NDUsX1NDXzJfVkVSU0lPTjo0NixcAF9TQ18yX0NfQklORDo0Nyxf
U0NfMl9DX0RFVjo0OCxfU0NfMl9GT1JUX0RFVjo0OSxcAF9TQ18yX0ZPUlRfUlVOOjUwLF9TQ18y
X1NXX0RFVjo1MSxfU0NfMl9MT0NBTEVERUY6NTIsXABfU0NfUElJOjUzLF9TQ19QSUlfWFRJOjU0
LF9TQ19QSUlfU09DS0VUOjU1LFwAX1NDX1BJSV9JTlRFUk5FVDo1NixfU0NfUElJX09TSTo1Nyxf
U0NfUE9MTDo1OCxcAF9TQ19TRUxFQ1Q6NTksX1NDX1VJT19NQVhJT1Y6NjAsX1NDX1BJSV9JTlRF
Uk5FVF9TVFJFQU06NjEsXABfU0NfUElJX0lOVEVSTkVUX0RHUkFNOjYyLF9TQ19QSUlfT1NJX0NP
VFM6NjMsX1NDX1BJSV9PU0lfQ0xUUzo2NCxcAF9TQ19QSUlfT1NJX006NjUsX1NDX1RfSU9WX01B
WDo2NixfU0NfVEhSRUFEUzo2NyxcAF9TQ19USFJFQURfU0FGRV9GVU5DVElPTlM6NjgsX1NDX0dF
VEdSX1JfU0laRV9NQVg6NjksXABfU0NfR0VUUFdfUl9TSVpFX01BWDo3MCxfU0NfTE9HSU5fTkFN
RV9NQVg6NzEsX1NDX1RUWV9OQU1FX01BWDo3MixcAF9TQ19USFJFQURfREVTVFJVQ1RPUl9JVEVS
QVRJT05TOjczLF9TQ19USFJFQURfS0VZU19NQVg6NzQsXABfU0NfVEhSRUFEX1NUQUNLX01JTjo3
NSxfU0NfVEhSRUFEX1RIUkVBRFNfTUFYOjc2LFwAX1NDX1RIUkVBRF9BVFRSX1NUQUNLQUREUjo3
NyxfU0NfVEhSRUFEX0FUVFJfU1RBQ0tTSVpFOjc4LFwAX1NDX1RIUkVBRF9QUklPUklUWV9TQ0hF
RFVMSU5HOjc5LF9TQ19USFJFQURfUFJJT19JTkhFUklUOjgwLFwAX1NDX1RIUkVBRF9QUklPX1BS
T1RFQ1Q6ODEsX1NDX1RIUkVBRF9QUk9DRVNTX1NIQVJFRDo4MixcAF9TQ19OUFJPQ0VTU09SU19D
T05GOjgzLF9TQ19OUFJPQ0VTU09SU19PTkxOOjg0LF9TQ19QSFlTX1BBR0VTOjg1LFwAX1NDX0FW
UEhZU19QQUdFUzo4NixfU0NfQVRFWElUX01BWDo4NyxfU0NfUEFTU19NQVg6ODgsXABfU0NfWE9Q
RU5fVkVSU0lPTjo4OSxfU0NfWE9QRU5fWENVX1ZFUlNJT046OTAsX1NDX1hPUEVOX1VOSVg6OTEs
XABfU0NfWE9QRU5fQ1JZUFQ6OTIsX1NDX1hPUEVOX0VOSF9JMThOOjkzLF9TQ19YT1BFTl9TSE06
OTQsXABfU0NfMl9DSEFSX1RFUk06OTUsX1NDXzJfQ19WRVJTSU9OOjk2LF9TQ18yX1VQRTo5Nyxc
AF9TQ19YT1BFTl9YUEcyOjk4LF9TQ19YT1BFTl9YUEczOjk5LF9TQ19YT1BFTl9YUEc0OjEwMCxc
AF9TQ19DSEFSX0JJVDoxMDEsX1NDX0NIQVJfTUFYOjEwMixfU0NfQ0hBUl9NSU46MTAzLFwAX1ND
X0lOVF9NQVg6MTA0LF9TQ19JTlRfTUlOOjEwNSxfU0NfTE9OR19CSVQ6MTA2LFwAX1NDX1dPUkRf
QklUOjEwNyxfU0NfTUJfTEVOX01BWDoxMDgsX1NDX05aRVJPOjEwOSxcAF9TQ19TU0laRV9NQVg6
MTEwLF9TQ19TQ0hBUl9NQVg6MTExLF9TQ19TQ0hBUl9NSU46MTEyLFwAX1NDX1NIUlRfTUFYOjEx
MyxfU0NfU0hSVF9NSU46MTE0LF9TQ19VQ0hBUl9NQVg6MTE1LFwAX1NDX1VJTlRfTUFYOjExNixf
U0NfVUxPTkdfTUFYOjExNyxfU0NfVVNIUlRfTUFYOjExOCxcAF9TQ19OTF9BUkdNQVg6MTE5LF9T
Q19OTF9MQU5HTUFYOjEyMCxfU0NfTkxfTVNHTUFYOjEyMSxcAF9TQ19OTF9OTUFYOjEyMixfU0Nf
TkxfU0VUTUFYOjEyMyxfU0NfTkxfVEVYVE1BWDoxMjQsXABfU0NfWEJTNV9JTFAzMl9PRkYzMjox
MjUsX1NDX1hCUzVfSUxQMzJfT0ZGQklHOjEyNixcAF9TQ19YQlM1X0xQNjRfT0ZGNjQ6MTI3LF9T
Q19YQlM1X0xQQklHX09GRkJJRzoxMjgsX1NDX1hPUEVOX0xFR0FDWToxMjksXABfU0NfWE9QRU5f
UkVBTFRJTUU6MTMwLF9TQ19YT1BFTl9SRUFMVElNRV9USFJFQURTOjEzMSw7ACA6VCgyMCwzKT1l
X0NTX1BBVEg6MCw7AC91c3IvaW5jbHVkZS9nZXRvcHQuaABwdHJkaWZmX3Q6dCgyMiwxKT0oMCwx
KQAvdXNyL2luY2x1ZGUvc2lnbmFsLmgAL3Vzci9pbmNsdWRlL2JpdHMvc2lnc2V0LmgAX19zaWdf
YXRvbWljX3Q6dCgyNCwxKT0oMCwxKQBfX3NpZ3NldF90OnQoMjQsMik9KDI0LDMpPXMxMjhfX3Zh
bDooMjQsNCk9YXIoMCwxKTswOzMxOygwLDUpLDAsMTAyNDs7AHNpZ19hdG9taWNfdDp0KDIzLDEp
PSgyNCwxKQBzaWdzZXRfdDp0KDIzLDIpPSgyNCwyKQAvdXNyL2luY2x1ZGUvYml0cy9zaWdudW0u
aABfX3NpZ2hhbmRsZXJfdDp0KDIzLDMpPSgyMyw0KT0qKDIzLDUpPWYoMCwxOSkAc2lnX3Q6dCgy
Myw2KT0oMjMsMykAL3Vzci9pbmNsdWRlL3RpbWUuaAB0aW1lc3BlYzpUKDI2LDEpPXM4dHZfc2Vj
OigwLDMpLDAsMzI7dHZfbnNlYzooMCwzKSwzMiwzMjs7AC91c3IvaW5jbHVkZS9iaXRzL3NpZ2lu
Zm8uaABzaWd2YWw6VCgyNywxKT11NHNpdmFsX2ludDooMCwxKSwwLDMyO3NpdmFsX3B0cjooNiwy
KSwwLDMyOzsAc2lndmFsX3Q6dCgyNywyKT0oMjcsMSkAc2lnaW5mbzpUKDI3LDMpPXMxMjhzaV9z
aWdubzooMCwxKSwwLDMyO3NpX2Vycm5vOigwLDEpLDMyLDMyO1wAc2lfY29kZTooMCwxKSw2NCwz
Mjtfc2lmaWVsZHM6KDI3LDQpPXUxMTZfcGFkOigyNyw1KT1hcigwLDEpOzA7Mjg7KDAsMSksMCw5
Mjg7XABfa2lsbDooMjcsNik9czhzaV9waWQ6KDcsMjUpLDAsMzI7c2lfdWlkOig3LDE4KSwzMiwz
Mjs7LDAsNjQ7XABfdGltZXI6KDI3LDcpPXM4X3RpbWVyMTooMCw0KSwwLDMyO190aW1lcjI6KDAs
NCksMzIsMzI7OywwLDY0O1wAX3J0OigyNyw4KT1zMTJzaV9waWQ6KDcsMjUpLDAsMzI7c2lfdWlk
Oig3LDE4KSwzMiwzMjtcAHNpX3NpZ3ZhbDooMjcsMiksNjQsMzI7OywwLDk2O19zaWdjaGxkOigy
Nyw5KT1zMjBzaV9waWQ6KDcsMjUpLDAsMzI7XABzaV91aWQ6KDcsMTgpLDMyLDMyO3NpX3N0YXR1
czooMCwxKSw2NCwzMjtzaV91dGltZTooNywzOCksOTYsMzI7XABzaV9zdGltZTooNywzOCksMTI4
LDMyOzssMCwxNjA7X3NpZ2ZhdWx0OigyNywxMCk9czRzaV9hZGRyOig2LDIpLDAsMzI7OywwLDMy
O1wAX3NpZ3BvbGw6KDI3LDExKT1zOHNpX2JhbmQ6KDAsMSksMCwzMjtzaV9mZDooMCwxKSwzMiwz
Mjs7LDAsNjQ7Oyw5Niw5Mjg7OwBzaWdpbmZvX3Q6dCgyNywxMik9KDI3LDMpACA6VCgyNywxMyk9
ZVNJX1NJR0lPOi01LFNJX0FTWU5DSU86LTQsU0lfTUVTR1E6LTMsXABTSV9USU1FUjotMixTSV9R
VUVVRTotMSxTSV9VU0VSOjAsOwAgOlQoMjcsMTQpPWVJTExfSUxMT1BDOjEsSUxMX0lMTE9QTjoy
LElMTF9JTExBRFI6MyxcAElMTF9JTExUUlA6NCxJTExfUFJWT1BDOjUsSUxMX1BSVlJFRzo2LFwA
SUxMX0NPUFJPQzo3LElMTF9CQURTVEs6OCw7ACA6VCgyNywxNSk9ZUZQRV9JTlRESVY6MSxGUEVf
SU5UT1ZGOjIsRlBFX0ZMVERJVjozLFwARlBFX0ZMVE9WRjo0LEZQRV9GTFRVTkQ6NSxGUEVfRkxU
UkVTOjYsXABGUEVfRkxUSU5WOjcsRlBFX0ZMVFNVQjo4LDsAIDpUKDI3LDE2KT1lU0VHVl9NQVBF
UlI6MSxTRUdWX0FDQ0VSUjoyLDsAIDpUKDI3LDE3KT1lQlVTX0FEUkFMTjoxLEJVU19BRFJFUlI6
MixCVVNfT0JKRVJSOjMsOwAgOlQoMjcsMTgpPWVUUkFQX0JSS1BUOjEsVFJBUF9UUkFDRToyLDsA
IDpUKDI3LDE5KT1lQ0xEX0VYSVRFRDoxLENMRF9LSUxMRUQ6MixDTERfRFVNUEVEOjMsXABDTERf
VFJBUFBFRDo0LENMRF9TVE9QUEVEOjUsQ0xEX0NPTlRJTlVFRDo2LDsAIDpUKDI3LDIwKT1lUE9M
TF9JTjoxLFBPTExfT1VUOjIsUE9MTF9NU0c6MyxcAFBPTExfRVJSOjQsUE9MTF9QUkk6NSxQT0xM
X0hVUDo2LDsAc2lnZXZlbnQ6VCgyNywyMSk9czY0c2lnZXZfdmFsdWU6KDI3LDIpLDAsMzI7c2ln
ZXZfc2lnbm86KDAsMSksMzIsMzI7XABzaWdldl9ub3RpZnk6KDAsMSksNjQsMzI7X3NpZ2V2X3Vu
OigyNywyMik9dTUyX3BhZDooMjcsMjMpPWFyKDAsMSk7MDsxMjsoMCwxKSwwLDQxNjtcAF9zaWdl
dl90aHJlYWQ6KDI3LDI0KT1zOF9mdW5jdGlvbjooMjcsMjUpPSooMjcsMjYpPWYoMCwxOSksMCwz
MjtcAF9hdHRyaWJ1dGU6KDYsMiksMzIsMzI7OywwLDY0OzssOTYsNDE2OzsAc2lnZXZlbnRfdDp0
KDI3LDI3KT0oMjcsMjEpACA6VCgyNywyOCk9ZVNJR0VWX1NJR05BTDowLFNJR0VWX05PTkU6MSxT
SUdFVl9USFJFQUQ6Miw7AC91c3IvaW5jbHVkZS9iaXRzL3NpZ2FjdGlvbi5oAHNpZ2FjdGlvbjpU
KDI4LDEpPXMxNDBfX3NpZ2FjdGlvbl9oYW5kbGVyOigyOCwyKT11NHNhX2hhbmRsZXI6KDIzLDMp
LDAsMzI7XABzYV9zaWdhY3Rpb246KDI4LDMpPSooMjgsNCk9ZigwLDE5KSwwLDMyOzssMCwzMjtc
AHNhX21hc2s6KDI0LDIpLDMyLDEwMjQ7c2FfZmxhZ3M6KDAsMSksMTA1NiwzMjtzYV9yZXN0b3Jl
cjooMjgsNSk9KigyOCw2KT1mKDAsMTkpLDEwODgsMzI7OwBzaWd2ZWM6VCgyMyw3KT1zMTJzdl9o
YW5kbGVyOigyMywzKSwwLDMyO3N2X21hc2s6KDAsMSksMzIsMzI7XABzdl9mbGFnczooMCwxKSw2
NCwzMjs7AC91c3IvaW5jbHVkZS9iaXRzL3NpZ2NvbnRleHQuaAAvdXNyL2luY2x1ZGUvYXNtL3Np
Z2NvbnRleHQuaABfZnByZWc6VCgzMCwxKT1zMTBzaWduaWZpY2FuZDooMzAsMik9YXIoMCwxKTsw
OzM7KDAsOSksMCw2NDtcAGV4cG9uZW50OigwLDkpLDY0LDE2OzsAX2Zwc3RhdGU6VCgzMCwzKT1z
MTEyY3c6KDAsNSksMCwzMjtzdzooMCw1KSwzMiwzMjtcAHRhZzooMCw1KSw2NCwzMjtpcG9mZjoo
MCw1KSw5NiwzMjtjc3NlbDooMCw1KSwxMjgsMzI7XABkYXRhb2ZmOigwLDUpLDE2MCwzMjtkYXRh
c2VsOigwLDUpLDE5MiwzMjtfc3Q6KDMwLDQpPWFyKDAsMSk7MDs3OygzMCwxKSwyMjQsNjQwO1wA
c3RhdHVzOigwLDUpLDg2NCwzMjs7AHNpZ2NvbnRleHQ6VCgzMCw1KT1zODhnczooMCw5KSwwLDE2
O19fZ3NoOigwLDkpLDE2LDE2O1wAZnM6KDAsOSksMzIsMTY7X19mc2g6KDAsOSksNDgsMTY7ZXM6
KDAsOSksNjQsMTY7XABfX2VzaDooMCw5KSw4MCwxNjtkczooMCw5KSw5NiwxNjtfX2RzaDooMCw5
KSwxMTIsMTY7XABlZGk6KDAsNSksMTI4LDMyO2VzaTooMCw1KSwxNjAsMzI7ZWJwOigwLDUpLDE5
MiwzMjtcAGVzcDooMCw1KSwyMjQsMzI7ZWJ4OigwLDUpLDI1NiwzMjtlZHg6KDAsNSksMjg4LDMy
O1wAZWN4OigwLDUpLDMyMCwzMjtlYXg6KDAsNSksMzUyLDMyO3RyYXBubzooMCw1KSwzODQsMzI7
XABlcnI6KDAsNSksNDE2LDMyO2VpcDooMCw1KSw0NDgsMzI7Y3M6KDAsOSksNDgwLDE2O1wAX19j
c2g6KDAsOSksNDk2LDE2O2VmbGFnczooMCw1KSw1MTIsMzI7ZXNwX2F0X3NpZ25hbDooMCw1KSw1
NDQsMzI7XABzczooMCw5KSw1NzYsMTY7X19zc2g6KDAsOSksNTkyLDE2O2Zwc3RhdGU6KDMwLDYp
PSooMzAsMyksNjA4LDMyO1wAb2xkbWFzazooMCw1KSw2NDAsMzI7Y3IyOigwLDUpLDY3MiwzMjs7
AC91c3IvaW5jbHVkZS9iaXRzL3NpZ3N0YWNrLmgAc2lnc3RhY2s6VCgzMSwxKT1zOHNzX3NwOig2
LDIpLDAsMzI7c3Nfb25zdGFjazooMCwxKSwzMiwzMjs7ACA6VCgzMSwyKT1lU1NfT05TVEFDSzox
LFNTX0RJU0FCTEU6Miw7AHNpZ2FsdHN0YWNrOlQoMzEsMyk9czEyc3Nfc3A6KDYsMiksMCwzMjtz
c19mbGFnczooMCwxKSwzMiwzMjtcAHNzX3NpemU6KDUsMSksNjQsMzI7OwBzdGFja190OnQoMzEs
NCk9KDMxLDMpAC91c3IvaW5jbHVkZS9zdGRsaWIuaABkaXZfdDp0KDMyLDEpPSgzMiwyKT1zOHF1
b3Q6KDAsMSksMCwzMjtyZW06KDAsMSksMzIsMzI7OwBsZGl2X3Q6dCgzMiwzKT0oMzIsNCk9czhx
dW90OigwLDMpLDAsMzI7cmVtOigwLDMpLDMyLDMyOzsAL3Vzci9pbmNsdWRlL3N5cy90eXBlcy5o
AHVfY2hhcjp0KDM0LDEpPSg3LDEpAHVfc2hvcnQ6dCgzNCwyKT0oNywyKQB1X2ludDp0KDM0LDMp
PSg3LDMpAHVfbG9uZzp0KDM0LDQpPSg3LDQpAHF1YWRfdDp0KDM0LDUpPSg3LDYpAHVfcXVhZF90
OnQoMzQsNik9KDcsNSkAZnNpZF90OnQoMzQsNyk9KDcsMzApAGxvZmZfdDp0KDM0LDgpPSg3LDI0
KQBpbm9fdDp0KDM0LDkpPSg3LDIwKQBkZXZfdDp0KDM0LDEwKT0oNywxNykAZ2lkX3Q6dCgzNCwx
MSk9KDcsMTkpAG1vZGVfdDp0KDM0LDEyKT0oNywyMSkAbmxpbmtfdDp0KDM0LDEzKT0oNywyMikA
dWlkX3Q6dCgzNCwxNCk9KDcsMTgpAHBpZF90OnQoMzQsMTUpPSg3LDI1KQBpZF90OnQoMzQsMTYp
PSg3LDI5KQBkYWRkcl90OnQoMzQsMTcpPSg3LDMzKQBjYWRkcl90OnQoMzQsMTgpPSg3LDM0KQBr
ZXlfdDp0KDM0LDE5KT0oNyw0MykAdGltZV90OnQoMzUsMSk9KDcsMzYpAHVsb25nOnQoMzQsMjAp
PSgwLDUpAHVzaG9ydDp0KDM0LDIxKT0oMCw5KQB1aW50OnQoMzQsMjIpPSgwLDQpAGludDhfdDp0
KDM0LDIzKT0oMCwxMCkAaW50MTZfdDp0KDM0LDI0KT0oMCw4KQBpbnQzMl90OnQoMzQsMjUpPSgw
LDEpAGludDY0X3Q6dCgzNCwyNik9KDAsNikAdV9pbnQ4X3Q6dCgzNCwyNyk9KDAsMTEpAHVfaW50
MTZfdDp0KDM0LDI4KT0oMCw5KQB1X2ludDMyX3Q6dCgzNCwyOSk9KDAsNCkAdV9pbnQ2NF90OnQo
MzQsMzApPSgwLDcpAHJlZ2lzdGVyX3Q6dCgzNCwzMSk9KDAsMSkAL3Vzci9pbmNsdWRlL2VuZGlh
bi5oAC91c3IvaW5jbHVkZS9iaXRzL2VuZGlhbi5oAC91c3IvaW5jbHVkZS9zeXMvc2VsZWN0LmgA
L3Vzci9pbmNsdWRlL2JpdHMvc2VsZWN0LmgAZmRfbWFzazp0KDM5LDEpPSg3LDM5KQBmZF9zZXQ6
dCgzOSwyKT0oNyw0MCkAL3Vzci9pbmNsdWRlL3N5cy9zeXNtYWNyb3MuaABibGtjbnRfdDp0KDM0
LDMyKT0oNyw0NSkAZnNibGtjbnRfdDp0KDM0LDMzKT0oNyw0NykAZnNmaWxjbnRfdDp0KDM0LDM0
KT0oNyw0OSkAcmFuZG9tX2RhdGE6VCgzMiw1KT1zMjhmcHRyOigzMiw2KT0qKDM0LDI1KSwwLDMy
O3JwdHI6KDMyLDYpLDMyLDMyO1wAc3RhdGU6KDMyLDYpLDY0LDMyO3JhbmRfdHlwZTooMCwxKSw5
NiwzMjtyYW5kX2RlZzooMCwxKSwxMjgsMzI7XAByYW5kX3NlcDooMCwxKSwxNjAsMzI7ZW5kX3B0
cjooMzIsNiksMTkyLDMyOzsAZHJhbmQ0OF9kYXRhOlQoMzIsNyk9czI0eDooMzIsOCk9YXIoMCwx
KTswOzI7KDAsOSksMCw0ODtcAGE6KDMyLDgpLDQ4LDQ4O2M6KDAsOSksOTYsMTY7b2xkX3g6KDMy
LDgpLDExMiw0ODtcAGluaXQ6KDAsMSksMTYwLDMyOzsAL3Vzci9pbmNsdWRlL2FsbG9jYS5oAF9f
Y29tcGFyX2ZuX3Q6dCgzMiw5KT0oMzIsMTApPSooMzIsMTEpPWYoMCwxKQBwNC9vbnRhcC9tYWlu
X2NsZWFuL3Byb2Qvc2ltL2xpbnV4L3NrLW9zZGVwL2Zha2VfcHRocmVhZC5jAC91c3IvaW5jbHVk
ZS9lcnJuby5oAC91c3IvaW5jbHVkZS9iaXRzL2Vycm5vLmgAL3Vzci9pbmNsdWRlL2xpbnV4L2Vy
cm5vLmgAL3Vzci9pbmNsdWRlL2FzbS9lcnJuby5oAC91c3IvaW5jbHVkZS9zeXMvcGFyYW0uaAAv
dXNyL2xpYi9nY2MtbGliL2kzODYtcmVkaGF0LWxpbnV4L2VnY3MtMi45MS42Ni9pbmNsdWRlL2xp
bWl0cy5oAC91c3IvbGliL2djYy1saWIvaTM4Ni1yZWRoYXQtbGludXgvZWdjcy0yLjkxLjY2L2lu
Y2x1ZGUvc3lzbGltaXRzLmgAL3Vzci9pbmNsdWRlL2xpbWl0cy5oAC91c3IvaW5jbHVkZS9iaXRz
L3Bvc2l4MV9saW0uaAAvdXNyL2luY2x1ZGUvYml0cy9sb2NhbF9saW0uaAAvdXNyL2luY2x1ZGUv
bGludXgvbGltaXRzLmgAL3Vzci9pbmNsdWRlL2JpdHMvcG9zaXgyX2xpbS5oAC91c3IvaW5jbHVk
ZS9saW51eC9wYXJhbS5oAC91c3IvaW5jbHVkZS9hc20vcGFyYW0uaAAvdXNyL2luY2x1ZGUvcHRo
cmVhZC5oAC91c3IvaW5jbHVkZS9zY2hlZC5oAC91c3IvaW5jbHVkZS9iaXRzL3NjaGVkLmgAc2No
ZWRfcGFyYW06VCg2NSwxKT1zNHNjaGVkX3ByaW9yaXR5OigwLDEpLDAsMzI7OwBfX3NjaGVkX3Bh
cmFtOlQoNjUsMik9czRzY2hlZF9wcmlvcml0eTooMCwxKSwwLDMyOzsAL3Vzci9pbmNsdWRlL2Jp
dHMvdGltZS5oAGNsb2NrX3Q6dCg2NiwxKT0oNywzOCkAdG06VCg2NiwyKT1zNDR0bV9zZWM6KDAs
MSksMCwzMjt0bV9taW46KDAsMSksMzIsMzI7XAB0bV9ob3VyOigwLDEpLDY0LDMyO3RtX21kYXk6
KDAsMSksOTYsMzI7dG1fbW9uOigwLDEpLDEyOCwzMjtcAHRtX3llYXI6KDAsMSksMTYwLDMyO3Rt
X3dkYXk6KDAsMSksMTkyLDMyO3RtX3lkYXk6KDAsMSksMjI0LDMyO1wAdG1faXNkc3Q6KDAsMSks
MjU2LDMyO3RtX2dtdG9mZjooMCwzKSwyODgsMzI7XAB0bV96b25lOig2NiwzKT0qKDAsMiksMzIw
LDMyOzsAL3Vzci9pbmNsdWRlL2JpdHMvcHRocmVhZHR5cGVzLmgAX3B0aHJlYWRfZmFzdGxvY2s6
VCg2OSwxKT1zOF9fc3RhdHVzOigwLDMpLDAsMzI7X19zcGlubG9jazooMCwxKSwzMiwzMjs7AF9w
dGhyZWFkX2Rlc2NyOnQoNjksMik9KDY5LDMpPSooNjksNCk9eHNfcHRocmVhZF9kZXNjcl9zdHJ1
Y3Q6AHB0aHJlYWRfYXR0cl90OnQoNjksNSk9KDY5LDYpPXMzNl9fZGV0YWNoc3RhdGU6KDAsMSks
MCwzMjtcAF9fc2NoZWRwb2xpY3k6KDAsMSksMzIsMzI7X19zY2hlZHBhcmFtOig2NSwyKSw2NCwz
MjtcAF9fZ3VhcmRzaXplOig1LDEpLDE2MCwzMjtfX3N0YWNrYWRkcl9zZXQ6KDAsMSksMTkyLDMy
O1wAX19zdGFja2FkZHI6KDYsMiksMjI0LDMyO19fc3RhY2tzaXplOig1LDEpLDI1NiwzMjs7AHB0
aHJlYWRfY29uZF90OnQoNjksNyk9KDY5LDgpPXMxMl9fY19sb2NrOig2OSwxKSwwLDY0O1wAX19j
X3dhaXRpbmc6KDY5LDIpLDY0LDMyOzsAcHRocmVhZF9jb25kYXR0cl90OnQoNjksOSk9KDY5LDEw
KT1zNF9fZHVtbXk6KDAsMSksMCwzMjs7AHB0aHJlYWRfa2V5X3Q6dCg2OSwxMSk9KDAsNCkAcHRo
cmVhZF9tdXRleF90OnQoNjksMTIpPSg2OSwxMyk9czI0X19tX3Jlc2VydmVkOigwLDEpLDAsMzI7
XABfX21fY291bnQ6KDAsMSksMzIsMzI7X19tX293bmVyOig2OSwyKSw2NCwzMjtcAF9fbV9raW5k
OigwLDEpLDk2LDMyO19fbV9sb2NrOig2OSwxKSwxMjgsNjQ7OwBwdGhyZWFkX211dGV4YXR0cl90
OnQoNjksMTQpPSg2OSwxNSk9czRfX211dGV4a2luZDooMCwxKSwwLDMyOzsAcHRocmVhZF9vbmNl
X3Q6dCg2OSwxNik9KDAsMSkAcHRocmVhZF90OnQoNjksMTcpPSgwLDUpACA6VCg2MiwxKT1lUFRI
UkVBRF9DUkVBVEVfSk9JTkFCTEU6MCxQVEhSRUFEX0NSRUFURV9ERVRBQ0hFRDoxLDsAIDpUKDYy
LDIpPWVQVEhSRUFEX0lOSEVSSVRfU0NIRUQ6MCxQVEhSRUFEX0VYUExJQ0lUX1NDSEVEOjEsOwAg
OlQoNjIsMyk9ZVBUSFJFQURfU0NPUEVfU1lTVEVNOjAsUFRIUkVBRF9TQ09QRV9QUk9DRVNTOjEs
OwAgOlQoNjIsNCk9ZVBUSFJFQURfTVVURVhfRkFTVF9OUDowLFBUSFJFQURfTVVURVhfUkVDVVJT
SVZFX05QOjEsXABQVEhSRUFEX01VVEVYX0VSUk9SQ0hFQ0tfTlA6Miw7ACA6VCg2Miw1KT1lUFRI
UkVBRF9QUk9DRVNTX1BSSVZBVEU6MCxQVEhSRUFEX1BST0NFU1NfU0hBUkVEOjEsOwBfcHRocmVh
ZF9jbGVhbnVwX2J1ZmZlcjpUKDYyLDYpPXMxNl9fcm91dGluZTooNjIsNyk9Kig2Miw4KT1mKDAs
MTkpLDAsMzI7XABfX2FyZzooNiwyKSwzMiwzMjtfX2NhbmNlbHR5cGU6KDAsMSksNjQsMzI7XABf
X3ByZXY6KDYyLDkpPSooNjIsNiksOTYsMzI7OwAgOlQoNjIsMTApPWVQVEhSRUFEX0NBTkNFTF9F
TkFCTEU6MCxQVEhSRUFEX0NBTkNFTF9ESVNBQkxFOjEsOwAgOlQoNjIsMTEpPWVQVEhSRUFEX0NB
TkNFTF9ERUZFUlJFRDowLFBUSFJFQURfQ0FOQ0VMX0FTWU5DSFJPTk9VUzoxLDsAL3Vzci9pbmNs
dWRlL2JpdHMvc2lndGhyZWFkLmgAL3Vzci9pbmNsdWRlL3N5cy9wcmN0bC5oAC91c3IvaW5jbHVk
ZS9saW51eC9wcmN0bC5oAC91c3IvaW5jbHVkZS9zeXMvd2FpdC5oAC91c3IvaW5jbHVkZS9iaXRz
L3dhaXRmbGFncy5oAF9fV0FJVF9TVEFUVVM6dCg3NCwxKT0oNzQsMik9dTRfX3VwdHI6KDc0LDMp
PSooNzQsNCk9eHV3YWl0OiwwLDMyO1wAX19pcHRyOig3NCw1KT0qKDAsMSksMCwzMjs7AC91c3Iv
aW5jbHVkZS9iaXRzL3dhaXRzdGF0dXMuaAB3YWl0OlQoNzQsNCk9dTR3X3N0YXR1czooMCwxKSww
LDMyO19fd2FpdF90ZXJtaW5hdGVkOig3NiwxKT1zNF9fd190ZXJtc2lnOigwLDQpLDAsNztcAF9f
d19jb3JlZHVtcDooMCw0KSw3LDE7X193X3JldGNvZGU6KDAsNCksOCw4O1wAOigwLDQpLDE2LDE2
OzssMCwzMjtfX3dhaXRfc3RvcHBlZDooNzYsMik9czRfX3dfc3RvcHZhbDooMCw0KSwwLDg7XABf
X3dfc3RvcHNpZzooMCw0KSw4LDg7OigwLDQpLDE2LDE2OzssMCwzMjs7ACA6VCg3NCw2KT1lUF9B
TEw6MCxQX1BJRDoxLFBfUEdJRDoyLDsAaWR0eXBlX3Q6dCg3NCw3KT0oNzQsNikAL3Vzci9pbmNs
dWRlL2Fzc2VydC5oAF9fbGliY190c2Rfa2V5X3Q6VCg0NiwxKT1lX0xJQkNfVFNEX0tFWV9NQUxM
T0M6MCxfTElCQ19UU0RfS0VZX0RMX0VSUk9SOjEsXABfTElCQ19UU0RfS0VZX1JFUzI6MixfTElC
Q19UU0RfS0VZX1JFUzM6MyxfTElCQ19UU0RfS0VZX1JFUzQ6NCxcAF9MSUJDX1RTRF9LRVlfUkVT
NTo1LF9MSUJDX1RTRF9LRVlfUkVTNjo2LF9MSUJDX1RTRF9LRVlfUkVTNzo3LFwAX0xJQkNfVFNE
X0tFWV9SRVM4OjgsX0xJQkNfVFNEX0tFWV9OOjksOwBmYWtlX3B0aHJlYWRfZGVzY3JfdDp0KDQ2
LDIpPSg0NiwzKT1zOTZwaWQ6KDAsMSksMCwzMjtcAGF0dHI6KDY5LDUpLDMyLDI4ODt0aHJlYWRf
ZXJybm9fcDooNzQsNSksMzIwLDMyO1wAdGhyZWFkX2Vycm5vOigwLDEpLDM1MiwzMjt0aHJlYWRf
c2lnX2Vycm5vOigwLDEpLDM4NCwzMjtcAHRocmVhZF9oX2Vycm5vX3A6KDc0LDUpLDQxNiwzMjt0
aHJlYWRfaF9lcnJubzooMCwxKSw0NDgsMzI7XABwX2xpYmNfc3BlY2lmaWM6KDQ2LDQpPWFyKDAs
MSk7MDs4Oyg2LDIpLDQ4MCwyODg7OwBmYWtlX3B0aHJlYWRfaGFuZGxlX3Q6dCg0Niw1KT0oNDYs
Nik9czRkZXNjcjooNDYsNyk9Kig0NiwyKSwwLDMyOzsAIDpUKDQ2LDgpPWVSRVFfQ1JFQVRFOjAs
UkVRX0RFQlVHOjEsOwBwdGhyZWFkX3JlcXVlc3RfdDp0KDQ2LDkpPSg0NiwxMCk9czE0OHJlcV9r
aW5kOig0Niw4KSwwLDMyO1wAcmVxX2FyZ3M6KDQ2LDExKT11MTQ0Y3JlYXRlOig0NiwxMik9czE0
NGF0dHI6KDQ2LDEzKT0qKDY5LDUpLDAsMzI7XABmbjooNDYsMTQpPSooNDYsMTUpPWYoNiwyKSwz
MiwzMjthcmc6KDYsMiksNjQsMzI7XAB0aV9wcDooNDYsMTYpPSooNDYsMTcpPSooNDYsNSksOTYs
MzI7bWFzazooMjMsMiksMTI4LDEwMjQ7OywwLDExNTI7OywzMiwxMTUyOzsAY2xvbmVfYXJnX3Q6
dCg0NiwxOCk9KDQ2LDE5KT1zMTQ0dXNlcl9mbjooNDYsMjApPSooOSwxNiksMCwzMjtcAHVzZXJf
YXJnOig2LDIpLDMyLDMyO3N5bmNfdmFyX2NoaWxkOigwLDEpLDY0LDMyO1wAc3luY192YXJfcGFy
ZW50OigwLDEpLDk2LDMyO21hc2s6KDIzLDIpLDEyOCwxMDI0OzsAX19wdGhyZWFkX2hhbmRsZXNf
bnVtOlMoMCwxKQBfX3B0aHJlYWRfaW5pdGVkOlMoMCwxKQBfX3B0aHJlYWRfaW5pdGlhbF90aHJl
YWQ6Ryg0NiwyKQBfX3B0aHJlYWRfbWFuYWdlcl90aHJlYWQ6Ryg0NiwyKQBfX3B0aHJlYWRfaGFu
ZGxlczpTKDQ2LDIxKT1hcigwLDEpOzA7MTU7KDQ2LDUpAF9fcHRocmVhZF9yZXFfcGlwZV9mZHM6
Uyg3LDMyKQBfX3B0aHJlYWRfcnNwX3BpcGVfZmRzOlMoNywzMikAX19wdGhyZWFkX2V4aXRfdmFs
OlMoMCwxKQBfX3B0aHJlYWRfYWJvcnRpbmdfcGlkOlMoMzQsMTUpAF9fcHRocmVhZF90aHJlYWRz
X21heDpHKDAsMSkAX19wdGhyZWFkX3NpemVvZl9oYW5kbGU6RygwLDEpAF9fcHRocmVhZF9vZmZz
ZXRvZl9kZXNjcjpHKDAsMSkAX19wdGhyZWFkX29mZnNldG9mX3BpZDpHKDAsMSkAX19wdGhyZWFk
X3NpZ19yZXN0YXJ0OkcoMCwxKQBfX3B0aHJlYWRfc2lnX2NhbmNlbDpHKDAsMSkAX19wdGhyZWFk
X3NpZ19kZWJ1ZzpHKDAsMSkAX19wdGhyZWFkX3NpZ19leGl0bm93OkcoMCwxKQBfX3B0aHJlYWRf
bWFuYWdlcl9mdW5jOmYoMCwxKQBhcmc6cCg2LDIpAHJlcTooNDYsOSkAcnNwOigwLDEpAHJjOigw
LDEpAGNsX2FyZ3M6KDQ2LDIyKT0qKDQ2LDE4KQB0aV9wOig0NiwxNykAcGlkOigwLDEpAGFyZ3M6
KDQ2LDE4KQBfX3B0aHJlYWRfY2xvbmVfZnVuYzpmKDAsMSkAY2xfYXJnczooNDYsMjIpAHVzZXJf
YXJnOig2LDIpAHVzZXJfZm46KDQ2LDIwKQBuZXdfbWFzazooMjMsMikAbWFzazooMjMsMikAX19w
dGhyZWFkX2NoZWNrX2luaXQ6ZigwLDEpAGFjdGlvbjooMjgsMSkAaTooMCwxKQBfX3B0aHJlYWRf
Y2hlY2tfbWFuYWdlcjpmKDAsMTkpAF9fcHRocmVhZF9yZWluaXQ6ZigwLDE5KQBwdGhyZWFkX2F0
dHJfaW5pdDpGKDAsMSkAYXR0cjpwKDQ2LDIzKT0qKDY5LDUpAHB0aHJlYWRfYXR0cl9zZXRzY29w
ZTpGKDAsMSkAYXR0cjpwKDQ2LDIzKQBzY29wZTpwKDAsMSkAcHRocmVhZF9hdHRyX3NldHN0YWNr
YWRkcjpGKDAsMSkAc3RhY2thZGRyOnAoNiwyKQBwdGhyZWFkX2F0dHJfc2V0c3RhY2tzaXplOkYo
MCwxKQBzdGFja3NpemU6cCg1LDEpAHB0aHJlYWRfY3JlYXRlOkYoMCwxKQB0aHJlYWRfcDpwKDQ2
LDI0KT0qKDY5LDE3KQBhdHRyOnAoNDYsMTMpAHN0YXJ0X3JvdXRpbmU6cCg0NiwxNCkAdGlfcHA6
KDQ2LDE2KQBwdGhyZWFkX2tpbGw6RigwLDEpAHRocmVhZDpwKDY5LDE3KQBzaWdubzpwKDAsMSkA
cHRocmVhZF9zZWxmOkYoNjksMTcpAHB0aHJlYWRfc2lnbWFzazpGKDAsMSkAaG93OnAoMCwxKQBu
ZXdtYXNrOnAoNDYsMjUpPSooMjMsMikAb2xkbWFzazpwKDQ2LDI2KT0qKDIzLDIpAHNpZ2FjdGlv
bjpGKDAsMSkAc2lnOnAoMCwxKQBhY3Q6cCg0NiwyNyk9KigyOCwxKQBvYWN0OnAoNDYsMjgpPSoo
MjgsMSkAbmV3YWN0OigyOCwxKQBuZXdhY3RwOig0NiwyOCkAX19wdGhyZWFkX3NpZ2hhbmRsZXI6
ZigwLDE5KQBvbGRfZXJybm9fcDooNzQsNSkAX19wdGhyZWFkX2hhbmRsZV9zaWdkZWJ1ZzpmKDAs
MTkpAF9fcHRocmVhZF9oYW5kbGVfc2lncmVzdGFydDpmKDAsMTkpAHB0aHJlYWRfZXhpdF9hbGw6
RigwLDE5KQBhcmc6cCgwLDEpAG15cGlkOigwLDEpAF9fcHRocmVhZF9oYW5kbGVfc2lnY2FuY2Vs
OmYoMCwxOSkAbXlwaWQ6KDM0LDE1KQBwaWQ6KDM0LDE1KQBfX3B0aHJlYWRfaGFuZGxlX3NpZ2No
aWxkOmYoMCwxOSkAc3RhdHVzOigwLDEpAHJjOigzNCwxNSkAX19wdGhyZWFkX2hhbmRsZV9zaWdl
eGl0bm93OmYoMCwxOSkAX19wdGhyZWFkX2hhbmRsZV9zaWdhYm9ydDpmKDAsMTkpAHNsZWVwX3Rp
bWU6KDI2LDEpAF9fZXJybm9fbG9jYXRpb246Rig3NCw1KQBfX2hfZXJybm9fbG9jYXRpb246Rig3
NCw1KQBsaWJjX2ludGVybmFsX3RzZF9zZXQ6ZigwLDEpAGtleTpwKDQ2LDEpAHBvaW50ZXI6cCg0
NiwyOSk9KigwLDE5KQBfX2xpYmNfaW50ZXJuYWxfdHNkX3NldDpHKDQ2LDMwKT0qKDQ2LDMxKT1m
KDAsMSkAbGliY19pbnRlcm5hbF90c2RfZ2V0OmYoNiwyKQBfX2xpYmNfaW50ZXJuYWxfdHNkX2dl
dDpHKDQ2LDMyKT0qKDQ2LDMzKT1mKDYsMikAcHRocmVhZF9tdXRleGF0dHJfaW5pdDpGKDAsMSkA
YXR0cjpwKDQ2LDM0KT0qKDY5LDE0KQBwdGhyZWFkX211dGV4YXR0cl9zZXR0eXBlOkYoMCwxKQBh
dHRyOnAoNDYsMzQpAHB0aHJlYWRfbXV0ZXhhdHRyX2Rlc3Ryb3k6RigwLDEpAHB0aHJlYWRfbXV0
ZXhfaW5pdDpGKDAsMSkAbTpwKDQ2LDM1KT0qKDY5LDEyKQBhdHRyOnAoNDYsMzYpPSooNjksMTQp
AHB0aHJlYWRfbXV0ZXhfbG9jazpGKDAsMSkAbTpwKDQ2LDM1KQBjbnQ6KDAsMSkAdG06KDI2LDEp
AHB0aHJlYWRfbXV0ZXhfdW5sb2NrOkYoMCwxKQBwdGhyZWFkX211dGV4X3RyeWxvY2s6RigwLDEp
AHB0aHJlYWRfbXV0ZXhfZGVzdHJveTpGKDAsMSkAX19wdGhyZWFkX3Rlc3RhbmRzZXQ6ZigwLDEp
AHNwaW5sb2NrOnAoNzQsNSkAcmV0OigwLDEpAGN1cnJlbnRfcnRtaW46UygwLDEpAGN1cnJlbnRf
cnRtYXg6UygwLDEpAF9fbGliY19jdXJyZW50X3NpZ3J0bWluOkYoMCwxKQBfX2xpYmNfY3VycmVu
dF9zaWdydG1heDpGKDAsMSkAX19saWJjX2FsbG9jYXRlX3J0c2lnOkYoMCwxKQBoaWdoOnAoMCwx
KQBraWxsYWxsOmYoMCwxOSkAdGVybV9zaWdoYW5kbGVyOmYoMCwxOSkAbWFpbjpGKDAsMSkAYXJn
YzpwKDAsMSkAYXJndjpwKDAsMjApPSooNywzNSkAdGhyZWFkczooMCwyMSk9YXIoMCwxKTswOzI7
KDY5LDE3KQBhdHRyOig2OSw1KQBzdGFjazooNywzNSkAbl90aHJlYWRzOigwLDEpAHByb2MxOmYo
NiwyKQBwOigwLDEpAGY6KDAsMjIpPSooMSwxKQBsaW5lOigwLDIzKT1hcigwLDEpOzA7Mjk7KDAs
MikAcHRyOig2LDIpAHNzOigzMSw0KQBza19wYW5pYzpGKDAsMTkpAGZtdDpwKDcsMzUpAHZhOigx
NCwxKQBfX3B0aHJlYWRfc2lnaGFuZGxlcnM6UygwLDI0KT1hcigwLDEpOzA7NjM7KDIzLDQpAF9f
cHRocmVhZF9tYW5hZ2VyX3N0YWNrOlMoMCwyNSk9YXIoMCwxKTswOzEwNDg1NzU7KDAsMikAX19w
dGhyZWFkX3RocmVhZHNfZGVidWc6RygwLDEpAGNvdW50OlMoMCwyNik9YXIoMCwxKTswOzk5Oygw
LDEpAGJwczpHKDAsMjcpPWFyKDAsMSk7MDs3Oyg2LDIpAABHQ0M6IChHTlUpIGVnY3MtMi45MS42
NiAxOTk5MDMxNC9MaW51eCAoZWdjcy0xLjEuMiByZWxlYXNlKQAAR0NDOiAoR05VKSBlZ2NzLTIu
OTEuNjYgMTk5OTAzMTQvTGludXggKGVnY3MtMS4xLjIgcmVsZWFzZSkAAEdDQzogKEdOVSkgZWdj
cy0yLjkxLjY2IDE5OTkwMzE0L0xpbnV4IChlZ2NzLTEuMS4yIHJlbGVhc2UpAABHQ0M6IChHTlUp
IGVnY3MtMi45MS42NiAxOTk5MDMxNC9MaW51eCAoZWdjcy0xLjEuMiByZWxlYXNlKQAAR0NDOiAo
R05VKSBlZ2NzLTIuOTEuNjYgMTk5OTAzMTQvTGludXggKGVnY3MtMS4xLjIgcmVsZWFzZSkAAEdD
QzogKEdOVSkgZWdjcy0yLjkxLjY2IDE5OTkwMzE0L0xpbnV4IChlZ2NzLTEuMS4yIHJlbGVhc2Up
AAgAAAAAAAAAAQAAADAxLjAxAAAACAAAAAAAAAABAAAAMDEuMDEAAAAIAAAAAAAAAAEAAAAwMS4w
MQAAAAgAAAAAAAAAAQAAADAxLjAxAAAACAAAAAAAAAABAAAAMDEuMDEAAAAIAAAAAAAAAAEAAAAw
MS4wMQAAAAAuc3ltdGFiAC5zdHJ0YWIALnNoc3RydGFiAC5pbnRlcnAALm5vdGUuQUJJLXRhZwAu
aGFzaAAuZHluc3ltAC5keW5zdHIALmdudS52ZXJzaW9uAC5nbnUudmVyc2lvbl9yAC5yZWwuZ290
AC5yZWwuYnNzAC5yZWwucGx0AC5pbml0AC5wbHQALnRleHQALmZpbmkALnJvZGF0YQAuZGF0YQAu
ZWhfZnJhbWUALmN0b3JzAC5kdG9ycwAuZ290AC5keW5hbWljAC5ic3MALnN0YWIALnN0YWJzdHIA
LmNvbW1lbnQALm5vdGUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAb
AAAAAQAAAAIAAAD0gAQI9AAAABMAAAAAAAAAAAAAAAEAAAAAAAAAIwAAAAcAAAACAAAACIEECAgB
AAAgAAAAAAAAAAAAAAAEAAAAAAAAADEAAAAFAAAAAgAAACiBBAgoAQAAhAEAAAQAAAAAAAAABAAA
AAQAAAA3AAAACwAAAAIAAACsggQIrAIAAKADAAAFAAAAAQAAAAQAAAAQAAAAPwAAAAMAAAACAAAA
TIYECEwGAADQAgAAAAAAAAAAAAABAAAAAAAAAEcAAAD///9vAgAAAByJBAgcCQAAdAAAAAQAAAAA
AAAAAgAAAAIAAABUAAAA/v//bwIAAACQiQQIkAkAADAAAAAFAAAAAQAAAAQAAAAAAAAAYwAAAAkA
AAACAAAAwIkECMAJAAAIAAAABAAAABQAAAAEAAAACAAAAGwAAAAJAAAAAgAAAMiJBAjICQAACAAA
AAQAAAAWAAAABAAAAAgAAAB1AAAACQAAAAIAAADQiQQI0AkAADABAAAEAAAADAAAAAQAAAAIAAAA
fgAAAAEAAAAGAAAAAIsECAALAAAvAAAAAAAAAAAAAAAEAAAAAAAAAIQAAAABAAAABgAAADCLBAgw
CwAAcAIAAAAAAAAAAAAABAAAAAQAAACJAAAAAQAAAAYAAACgjQQIoA0AAGwaAAAAAAAAAAAAABAA
AAAAAAAAjwAAAAEAAAAGAAAADKgECAwoAAAaAAAAAAAAAAAAAAAEAAAAAAAAAJUAAAABAAAAAgAA
AECoBAhAKAAAGgIAAAAAAAAAAAAAIAAAAAAAAACdAAAAAQAAAAMAAABgugQIYCoAAGgBAAAAAAAA
AAAAACAAAAAAAAAAowAAAAEAAAADAAAAyLsECMgrAAAEAAAAAAAAAAAAAAAEAAAAAAAAAK0AAAAB
AAAAAwAAAMy7BAjMKwAACAAAAAAAAAAAAAAABAAAAAAAAAC0AAAAAQAAAAMAAADUuwQI1CsAAAgA
AAAAAAAAAAAAAAQAAAAAAAAAuwAAAAEAAAADAAAA3LsECNwrAACoAAAAAAAAAAAAAAAEAAAABAAA
AMAAAAAGAAAAAwAAAIS8BAiELAAAoAAAAAUAAAAAAAAABAAAAAgAAADJAAAACAAAAAMAAABAvQQI
QC0AAOQCEAAAAAAAAAAAACAAAAAAAAAAzgAAAAEAAAAAAAAAAAAAAEAtAAAYRQAAGAAAAAAAAAAE
AAAADAAAANQAAAADAAAAAAAAAAAAAABYcgAAaVoAAAAAAAAAAAAAAQAAAAAAAADdAAAAAQAAAAAA
AAAAAAAAwcwAAG4BAAAAAAAAAAAAAAEAAAAAAAAA5gAAAAcAAAAAAAAAJMAUCC/OAAB4AAAAAAAA
AAAAAAABAAAAAAAAABEAAAADAAAAAAAAAAAAAACnzgAA7AAAAAAAAAAAAAAAAQAAAAAAAAABAAAA
AgAAAAAAAAAAAAAARNQAADALAAAdAAAAVwAAAAQAAAAQAAAACQAAAAMAAAAAAAAAAAAAAHTfAAAI
CgAAAAAAAAAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA9IAECAAAAAADAAEAAAAAAAiB
BAgAAAAAAwACAAAAAAAogQQIAAAAAAMAAwAAAAAArIIECAAAAAADAAQAAAAAAEyGBAgAAAAAAwAF
AAAAAAAciQQIAAAAAAMABgAAAAAAkIkECAAAAAADAAcAAAAAAMCJBAgAAAAAAwAIAAAAAADIiQQI
AAAAAAMACQAAAAAA0IkECAAAAAADAAoAAAAAAACLBAgAAAAAAwALAAAAAAAwiwQIAAAAAAMADAAA
AAAAoI0ECAAAAAADAA0AAAAAAAyoBAgAAAAAAwAOAAAAAABAqAQIAAAAAAMADwAAAAAAYLoECAAA
AAADABAAAAAAAMi7BAgAAAAAAwARAAAAAADMuwQIAAAAAAMAEgAAAAAA1LsECAAAAAADABMAAAAA
ANy7BAgAAAAAAwAUAAAAAACEvAQIAAAAAAMAFQAAAAAAQL0ECAAAAAADABYAAAAAAAAAAAAAAAAA
AwAXAAAAAAAAAAAAAAAAAAMAGAAAAAAAAAAAAAAAAAADABkAAAAAACTAFAgAAAAAAwAaAAAAAAAA
AAAAAAAAAAMAGwAAAAAAAAAAAAAAAAADABwAAAAAAAAAAAAAAAAAAwAdAAEAAAAAAAAAAAAAAAQA
8f8MAAAAxI0ECAAAAAAAAA0AGwAAAAAAAAAAAAAABADx/yIAAAAAAAAAAAAAAAQA8f8MAAAA0I0E
CAAAAAAAAA0ALQAAAGS6BAgAAAAAAQAQADEAAADUuwQIAAAAAAEAEwA/AAAAaLoECAAAAAABABAA
SwAAANCNBAgAAAAAAgANAGEAAADIuwQIAAAAAAEAEQB0AAAAGI4ECAAAAAACAA0AfwAAAES9BAgY
AAAAAQAWAIgAAAAgjgQIAAAAAAIADQCUAAAAQI4ECAAAAAACAA0AnwAAAGy6BAgAAAAAAQAQAK0A
AADMuwQIAAAAAAEAEgAiAAAAAAAAAAAAAAAEAPH/DAAAAOCnBAgAAAAAAAANALsAAADgpwQIAAAA
AAIADQDRAAAA0LsECAAAAAABABIAlAAAAASoBAgAAAAAAgANAJ8AAADIuwQIAAAAAAEAEADeAAAA
2LsECAAAAAABABMA6wAAAMi7BAgAAAAAAQARAAEAAAAAAAAAAAAAAAQA8f8MAAAADKgECAAAAAAA
AA0A+QAAAAAAAAAAAAAABADx/wgBAACAugQIBAAAAAEAEAAeAQAAhLoECAQAAAABABAALwEAAGC7
BAhAAAAAAQAQAEEBAACguwQICAAAAAEAEABYAQAAqLsECAgAAAABABAAbwEAALC7BAgEAAAAAQAQ
AIIBAAC0uwQIBAAAAAEAEACZAQAAUI4ECA0DAAACAA0AsAEAAGCRBAgYAgAAAgANAMUBAAB4kwQI
LgQAAAIADQDaAQAAEJkECMkAAAACAA0A6wEAANieBAgFAAAAAgANAAUCAADgngQIBQAAAAIADQAh
AgAAQJ8ECPIAAAACAA0APAIAAKSgBAhOAAAAAgANAFgCAAA0oAQIbgAAAAIADQByAgAA9KAECCYC
AAACAA0AjAIAAKiXBAhoAQAAAgANAKQCAABgvgQIAAAQAAEAFgC8AgAAYJ4ECHYAAAACAA0A0QIA
AGC9BAgAAQAAAQAWAOcCAABUowQIQQAAAAIADQD9AgAAmKMECD4AAAACAA0AEwMAANSkBAgfAAAA
AgANACgDAADAuwQIBAAAAAEAEAA2AwAAxLsECAQAAAABABAARAMAAGSlBAgRAAAAAgANAEwDAAB4
pQQIEQAAAAIADQBcAwAAhKYECP4AAAACAA0AYgMAAGC+FAiQAQAAAQAWAGgDAAC4uwQIBAAAABEA
EACAAwAAQIsECGwAAAASAAAAkQMAAHyoBAgEAAAAEQAPAKcDAADYmgQImgEAABIADQC2AwAAUIsE
CB4AAAASAAAAyQMAANyZBAh6AAAAEgANANsDAABgiwQILwAAABIAAADtAwAAhLwECAAAAAARABUA
9gMAAHCLBAg7AAAAEgAAAAsEAAAMqAQIAAAAABEA8f8SBAAAgIsECHQAAAAiAAAAMwQAAJCLBAg9
AAAAEgAAAEQEAAAEpQQIDwAAABIADQBcBAAAAAAAAAQAAAAQAAAAYwQAAKCLBAgkAAAAEgAAAHYE
AAD0owQIDgAAABIADQCQBAAA9KQECA8AAAASAA0AqAQAAHioBAgEAAAAEQAPALwEAACwiwQIzgAA
ABIAAADVBAAAwIsECH8AAAASAAAA5gQAAACLBAgAAAAAEgALAOwEAADQiwQIOQAAABIAAAD+BAAA
lJoECB4AAAASAA0AGAUAAOCLBAhJAAAAEgAAACkFAADwiwQItwEAABIAAAA7BQAAFKUECE4AAAAS
AA0AUQUAAACMBAgvAAAAEgAAAGgFAAC8uwQIBAAAABEAEACABQAAEIwECDcAAAASAAAAkAUAACCM
BAiiAAAAIgAAALMFAABYmgQIOgAAABIADQDJBQAAQL0ECAQAAAARABYA2wUAADCMBAizAQAAEgAA
AOwFAAAAuwQIYAAAABEAEAAFBgAAQIwECJlJAAASAAAAGQYAAFCMBAglAAAAEgAAACwGAACgjQQI
AAAAABAADQAzBgAAdJwECE4AAAASAA0AQAYAALSaBAgiAAAAEgANAFoGAACEpwQITwAAABIADQBj
BgAAYIwECLAAAAASAAAAdAYAAHCMBAgfAAAAEgAAAIYGAACAjAQIVAAAABIAAACbBgAAJJ0ECDUA
AAASAA0AqwYAAFydBAgCAQAAEgANALUGAACQjAQIuAAAABIAAADMBgAAJL0ECAAAAAARAPH/2AYA
AIylBAj2AAAAEgANAN0GAACgjAQIBQEAABIAAAD6BgAAsIwECCMAAAASAAAACwcAAOSjBAgOAAAA
EgANACUHAACEpAQIEwAAABIADQA6BwAAYLoECAAAAAAgABAARQcAAKC6BAhgAAAAEQAQAF4HAAA4
owQIHAAAABIADQBxBwAADKgECAAAAAASAA4AdwcAAGioBAgEAAAAEQAPAJAHAADAjAQIJwAAABIA
AACkBwAA0IwECDsAAAASAAAAuwcAAMScBAheAAAAEgANAMgHAADgjAQIMwAAABIAAADZBwAA2KME
CAoAAAASAA0A8AcAAPCMBAjoAAAAEgAAAAAIAAAAjQQIIwAAABIAAAAQCAAAEI0ECKwAAAASAAAA
JggAACS9BAgAAAAAEQDx/y0IAADcuwQIAAAAABEAFABDCAAAII0ECMcAAAASAAAAUwgAACTAFAgA
AAAAEQDx/1gIAABgqAQIBAAAABEADwBuCAAAyKQECAoAAAASAA0AhAgAAOieBAhXAAAAEgANAJUI
AAAYpAQIagAAABIADQCoCAAAMI0ECDYAAAASAAAAuQgAAByjBAgcAAAAEgANAMoIAABAjQQIOwAA
ABIAAADhCAAAmKQECC4AAAASAA0A9wgAAFCNBAh5AAAAEgAAAAgJAABEqAQIBAAAABEADwAXCQAA
dKgECAQAAAARAA8ALAkAAHCoBAgEAAAAEQAPAEIJAABsqAQIBAAAABEADwBZCQAAYI0ECDsAAAAS
AAAAaQkAAASkBAgTAAAAEgANAHwJAABwjQQIUwIAABIAAACTCQAAYLoECAAAAAAQABAAoAkAAGSo
BAgEAAAAEQAPALgJAAAAwBQIIAAAABEAFgC8CQAAIMAUCAQAAAARABYA1AkAAICNBAhYAAAAEgAA
AOkJAACQjQQIPQAAABIAAAD5CQAAAAAAAAAAAAAgAAAAAGluaXRmaW5pLmMAZ2NjMl9jb21waWxl
ZC4AaW5pdC5jAGNydHN0dWZmLmMAcC4yAF9fRFRPUl9MSVNUX18AY29tcGxldGVkLjMAX19kb19n
bG9iYWxfZHRvcnNfYXV4AF9fRUhfRlJBTUVfQkVHSU5fXwBmaW5pX2R1bW15AG9iamVjdC44AGZy
YW1lX2R1bW15AGluaXRfZHVtbXkAZm9yY2VfdG9fZGF0YQBfX0NUT1JfTElTVF9fAF9fZG9fZ2xv
YmFsX2N0b3JzX2F1eABfX0NUT1JfRU5EX18AX19EVE9SX0VORF9fAF9fRlJBTUVfRU5EX18AdGVz
dC1wdGhyZWFkLmMAX19wdGhyZWFkX2hhbmRsZXNfbnVtAF9fcHRocmVhZF9pbml0ZWQAX19wdGhy
ZWFkX2hhbmRsZXMAX19wdGhyZWFkX3JlcV9waXBlX2ZkcwBfX3B0aHJlYWRfcnNwX3BpcGVfZmRz
AF9fcHRocmVhZF9leGl0X3ZhbABfX3B0aHJlYWRfYWJvcnRpbmdfcGlkAF9fcHRocmVhZF9tYW5h
Z2VyX2Z1bmMAX19wdGhyZWFkX2Nsb25lX2Z1bmMAX19wdGhyZWFkX2NoZWNrX2luaXQAX19wdGhy
ZWFkX3JlaW5pdABfX3B0aHJlYWRfaGFuZGxlX3NpZ2RlYnVnAF9fcHRocmVhZF9oYW5kbGVfc2ln
cmVzdGFydABfX3B0aHJlYWRfaGFuZGxlX3NpZ2NhbmNlbABfX3B0aHJlYWRfaGFuZGxlX3NpZ2V4
aXRub3cAX19wdGhyZWFkX2hhbmRsZV9zaWdjaGlsZABfX3B0aHJlYWRfaGFuZGxlX3NpZ2Fib3J0
AF9fcHRocmVhZF9jaGVja19tYW5hZ2VyAF9fcHRocmVhZF9tYW5hZ2VyX3N0YWNrAF9fcHRocmVh
ZF9zaWdoYW5kbGVyAF9fcHRocmVhZF9zaWdoYW5kbGVycwBsaWJjX2ludGVybmFsX3RzZF9zZXQA
bGliY19pbnRlcm5hbF90c2RfZ2V0AF9fcHRocmVhZF90ZXN0YW5kc2V0AGN1cnJlbnRfcnRtaW4A
Y3VycmVudF9ydG1heABraWxsYWxsAHRlcm1fc2lnaGFuZGxlcgBwcm9jMQBjb3VudABfX2xpYmNf
aW50ZXJuYWxfdHNkX3NldABjbG9uZUBAR0xJQkNfMi4wAF9fcHRocmVhZF9zaWdfZXhpdG5vdwBw
dGhyZWFkX2NyZWF0ZQBzZXRwZ3JwQEBHTElCQ18yLjAAcHRocmVhZF9hdHRyX2luaXQAZ2V0cGlk
QEBHTElCQ18yLjAAX0RZTkFNSUMAbmFub3NsZWVwQEBHTElCQ18yLjAAX2V0ZXh0AF9fcmVnaXN0
ZXJfZnJhbWVfaW5mb0BAR0xJQkNfMi4wAHdyaXRlQEBHTElCQ18yLjAAX19saWJjX2N1cnJlbnRf
c2lncnRtYXgAX2ZwX2h3AGZwcmludGZAQEdMSUJDXzIuMABwdGhyZWFkX211dGV4YXR0cl9kZXN0
cm95AF9fbGliY19jdXJyZW50X3NpZ3J0bWluAF9fcHRocmVhZF9zaWdfZGVidWcAX19hc3NlcnRf
ZmFpbEBAR0xJQkNfMi4wAGJjb3B5QEBHTElCQ18yLjAAX2luaXQAa2lsbHBnQEBHTElCQ18yLjAA
cHRocmVhZF9hdHRyX3NldHN0YWNrYWRkcgBwcmN0bEBAR0xJQkNfMi4wAG1hbGxvY0BAR0xJQkNf
Mi4wAF9fbGliY19hbGxvY2F0ZV9ydHNpZwBzY2hlZF95aWVsZEBAR0xJQkNfMi4wAF9fbGliY19p
bnRlcm5hbF90c2RfZ2V0AHBpcGVAQEdMSUJDXzIuMABfX2RlcmVnaXN0ZXJfZnJhbWVfaW5mb0BA
R0xJQkNfMi4wAHB0aHJlYWRfYXR0cl9zZXRzY29wZQBzdGRlcnJAQEdMSUJDXzIuMABhYm9ydEBA
R0xJQkNfMi4wAF9fcHRocmVhZF9tYW5hZ2VyX3RocmVhZAB2ZnByaW50ZkBAR0xJQkNfMi4wAHdh
aXRwaWRAQEdMSUJDXzIuMABfc3RhcnQAcHRocmVhZF9raWxsAHB0aHJlYWRfYXR0cl9zZXRzdGFj
a3NpemUAc2tfcGFuaWMAZnB1dHNAQEdMSUJDXzIuMABzdHJsZW5AQEdMSUJDXzIuMABzaWdhZGRz
ZXRAQEdMSUJDXzIuMABwdGhyZWFkX3NpZ21hc2sAc2lnYWN0aW9uAHNpZ3Byb2NtYXNrQEBHTElC
Q18yLjAAX19ic3Nfc3RhcnQAbWFpbgBfX2xpYmNfc3RhcnRfbWFpbkBAR0xJQkNfMi4wAHJhaXNl
QEBHTElCQ18yLjAAcHRocmVhZF9tdXRleGF0dHJfc2V0dHlwZQBwdGhyZWFkX211dGV4X3VubG9j
awBkYXRhX3N0YXJ0AF9fcHRocmVhZF9pbml0aWFsX3RocmVhZABfX2hfZXJybm9fbG9jYXRpb24A
X2ZpbmkAX19wdGhyZWFkX29mZnNldG9mX2Rlc2NyAHNucHJpbnRmQEBHTElCQ18yLjAAc2lnZW1w
dHlzZXRAQEdMSUJDXzIuMABwdGhyZWFkX3NlbGYAYnplcm9AQEdMSUJDXzIuMABwdGhyZWFkX211
dGV4YXR0cl9pbml0AGV4aXRAQEdMSUJDXzIuMABhdG9pQEBHTElCQ18yLjAAc2lnc3VzcGVuZEBA
R0xJQkNfMi4wAF9lZGF0YQBfR0xPQkFMX09GRlNFVF9UQUJMRV8AZnJlZUBAR0xJQkNfMi4wAF9l
bmQAX19wdGhyZWFkX3RocmVhZHNfbWF4AHB0aHJlYWRfbXV0ZXhfZGVzdHJveQBwdGhyZWFkX2V4
aXRfYWxsAHB0aHJlYWRfbXV0ZXhfbG9jawBfZXhpdEBAR0xJQkNfMi4wAF9fZXJybm9fbG9jYXRp
b24Ac2lnYWx0c3RhY2tAQEdMSUJDXzIuMABwdGhyZWFkX211dGV4X3RyeWxvY2sAZm9wZW5AQEdM
SUJDXzIuMQBfSU9fc3RkaW5fdXNlZABfX3B0aHJlYWRfc2lnX2NhbmNlbABfX3B0aHJlYWRfc2ln
X3Jlc3RhcnQAX19wdGhyZWFkX29mZnNldG9mX3BpZABraWxsQEBHTElCQ18yLjAAcHRocmVhZF9t
dXRleF9pbml0AF9fc2lnYWN0aW9uQEBHTElCQ18yLjAAX19kYXRhX3N0YXJ0AF9fcHRocmVhZF9z
aXplb2ZfaGFuZGxlAGJwcwBfX3B0aHJlYWRfdGhyZWFkc19kZWJ1ZwBzaWdkZWxzZXRAQEdMSUJD
XzIuMAByZWFkQEBHTElCQ18yLjAAX19nbW9uX3N0YXJ0X18A



More information about the Gdb-prs mailing list